Rh4BG302500

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr4B
Physical Location & Seq
Reverse (-)
47330926 .. 47331456
531 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh4BG302500.1

Sequence Viewer

Length: 213 bp
ATGGGTGATGTCATGGTCTTGATGCCCAGTACTCCAGTAGAATATATCTACTCCATGCAAACCAATGAATCTAGATATTGTACATGTTTGTTTGGTTTTGAGGAGGAGGTTAAGAGTTCATACTGCAGTGGGGTTTTTCTAAAACAATCGAACTTCAAGCCTGTGGAGTTCATGTGCAAAGGGGATCAATTTCTGTACCCAGCAAGAGAATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

70

Amino Acids

8.12

Weight (kDa)

4.78

Isoelectric Point (pI)

49.95

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 192
AfaI GTAC 3 cut(s) 31, 82, 197
AflIII ACRYGT 1 cut(s) 83
AgsI TTSAA 1 cut(s) 157
AlwI GGATC 1 cut(s) 192
AsuHPI GGTGA 1 cut(s) 17
BfaI CTAG 1 cut(s) 72
BfmI CTRYAG 1 cut(s) 124
BmcAI AGTACT 1 cut(s) 31
BmrI ACTGGG 1 cut(s) 21
BmsI GCATC 1 cut(s) 12
BmuI ACTGGG 1 cut(s) 21
BpmI CTGGAG 1 cut(s) 18
BsaXI ACNNNNNCTCC 2 cut(s) 158, 188
Bse1I ACTGG 2 cut(s) 27, 35
BseNI ACTGG 2 cut(s) 27, 35
BseRI GAGGAG 2 cut(s) 116, 119
BseYI CCCAGC 1 cut(s) 199
Bsp1407I TGTACA 1 cut(s) 80
Bsp143I GATC 1 cut(s) 184
BspMAI CTGCAG 1 cut(s) 128
BspPI GGATC 1 cut(s) 192
BsrGI TGTACA 1 cut(s) 80
BsrI ACTGG 2 cut(s) 27, 35
BssMI GATC 1 cut(s) 184
BstAUI TGTACA 1 cut(s) 80
BstKTI GATC 1 cut(s) 187
BstMBI GATC 1 cut(s) 184
BstNSI RCATGY 1 cut(s) 87
BstSFI CTRYAG 1 cut(s) 124
BtsI GCAGTG 1 cut(s) 133
BtsIMutI CAGTG 1 cut(s) 133
Csp6I GTAC 3 cut(s) 30, 81, 196
CviAII CATG 4 cut(s) 13, 55, 84, 172
CviJI RGCY 1 cut(s) 160
CviKI_1 RGCY 1 cut(s) 160
CviQI GTAC 3 cut(s) 30, 81, 196
DpnI GATC 1 cut(s) 186
DpnII GATC 1 cut(s) 184
FaeI CATG 4 cut(s) 16, 58, 87, 175
FaiI YATR 6 cut(s) 14, 45, 56, 85, 121, 173
FatI CATG 4 cut(s) 12, 54, 83, 171
FspBI CTAG 1 cut(s) 72
GsaI CCCAGC 1 cut(s) 203
GsuI CTGGAG 1 cut(s) 18
Hin1II CATG 4 cut(s) 16, 58, 87, 175
HinfI GANTC 1 cut(s) 68
HphI GGTGA 1 cut(s) 17
Hpy188III TCNNGA 2 cut(s) 19, 72
HpyCH4V TGCA 3 cut(s) 58, 126, 177
Hsp92II CATG 4 cut(s) 16, 58, 87, 175
Kzo9I GATC 1 cut(s) 184
LpnPI CCDG 3 cut(s) 40, 48, 174
LweI GCATC 1 cut(s) 12
MaeI CTAG 1 cut(s) 72
MalI GATC 1 cut(s) 186
MboI GATC 1 cut(s) 184
MluCI AATT 1 cut(s) 188
MnlI CCTC 3 cut(s) 94, 97, 100
MseI TTAA 1 cut(s) 111
NdeII GATC 1 cut(s) 184
NlaIII CATG 4 cut(s) 16, 58, 87, 175
NspI RCATGY 1 cut(s) 87
PciI ACATGT 1 cut(s) 83
PfeI GAWTC 1 cut(s) 68
PscI ACATGT 1 cut(s) 83
PspFI CCCAGC 1 cut(s) 199
PstI CTGCAG 1 cut(s) 128
RsaI GTAC 3 cut(s) 31, 82, 197
RsaNI GTAC 3 cut(s) 30, 81, 196
SaqAI TTAA 1 cut(s) 111
Sau3AI GATC 1 cut(s) 184
ScaI AGTACT 1 cut(s) 31
SetI ASST 1 cut(s) 111
SfaNI GCATC 1 cut(s) 12
SfcI CTRYAG 1 cut(s) 124
Sse9I AATT 1 cut(s) 188
SspMI CTAG 1 cut(s) 72
TaqI TCGA 1 cut(s) 149
TasI AATT 1 cut(s) 188
TatI WGTACW 2 cut(s) 29, 80
TfiI GAWTC 1 cut(s) 68
Tru1I TTAA 1 cut(s) 111
Tru9I TTAA 1 cut(s) 111
TscAI CASTG 1 cut(s) 133
TspDTI ATGAA 3 cut(s) 81, 108, 160
TspRI CASTG 1 cut(s) 133
XbaI TCTAGA 1 cut(s) 71
XceI RCATGY 1 cut(s) 87
XspI CTAG 1 cut(s) 72
ZrmI AGTACT 1 cut(s) 31
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.