RchiOBHm_Chr7g0241041
WRKY Family

WRKY transcription factor

Basic Information

Type: gene
Biological Identity
rosa_chinensis
7
Physical Location & Seq
Reverse (-)
67010241 .. 67013191
2951 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ21604

Sequence Viewer

Length: 429 bp
ATGATTAGGCCAAAAACCCAGGCATCCAAAAGGAAGGTGGCTCATCAGAAGAATGAAGGGCCTCCTTCTGATTTCTGGTCATGGAGGAAATATGGGCAAAAACCTATCAAAGGATCTCCTTATCCAAGAGGGTACTACAGGTGCAGTACATCAAAGGGTTGTTCTGCCAAGAAACAAGTGGAGAGAAGCAAAACTGATGCTTCTGTGCTCATAATCACCTACACTAACAGCCACAACCATCGAGGTCCTCATGTGACCTCCACCACTAAAAACCAGAGCCCACCACCAAAAGAAGCCCAAATGCAAACCAATAGTGAGGATGATGATCATGATCTTACAGCTGAAGTGCCCAAAGAGGATGAACCAGAGCCTGAGCCAGATCAAGACGAAGAACAAGAACAAGAAAGGAAGGTAGATGAATATGAATAG

Protein Analysis

142

Amino Acids

16.33

Weight (kDa)

6.23

Isoelectric Point (pI)

41.15

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
WRKY PF03106 24 - 80 5.8e-26 WRKY DNA -binding domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 121
AcuI CTGAAG 1 cut(s) 363
AfaI GTAC 2 cut(s) 134, 148
AfiI CCNNNNNNNGG 1 cut(s) 110
AjnI CCWGG 1 cut(s) 18
AluBI AGCT 1 cut(s) 341
AluI AGCT 1 cut(s) 341
Alw21I GWGCWC 1 cut(s) 210
AlwI GGATC 1 cut(s) 121
AlwNI CAGNNNCTG 1 cut(s) 371
AoxI GGCC 2 cut(s) 8, 59
AspS9I GGNCC 2 cut(s) 59, 245
AsuHPI GGTGA 1 cut(s) 208
AvaII GGWCC 1 cut(s) 245
BaeGI GKGCMC 1 cut(s) 351
BanII GRGCYC 1 cut(s) 281
Bbv12I GWGCWC 1 cut(s) 210
BccI CCATC 1 cut(s) 246
BciT130I CCWGG 1 cut(s) 20
BclI TGATCA 1 cut(s) 325
BfmI CTRYAG 1 cut(s) 136
Bme1390I CCNGG 1 cut(s) 20
Bme18I GGWCC 1 cut(s) 245
BmgT120I GGNCC 2 cut(s) 59, 245
BmrFI CCNGG 1 cut(s) 20
BmsI GCATC 2 cut(s) 32, 187
Bpu10I CCTNAGC 1 cut(s) 372
BsaBI GATNNNNATC 2 cut(s) 324, 330
BsaJI CCNNGG 1 cut(s) 18
Bsc4I CCNNNNNNNGG 1 cut(s) 110
Bse8I GATNNNNATC 2 cut(s) 324, 330
BseBI CCWGG 1 cut(s) 20
BseDI CCNNGG 1 cut(s) 18
BseGI GGATG 3 cut(s) 23, 325, 364
BseJI GATNNNNATC 2 cut(s) 324, 330
BseLI CCNNNNNNNGG 1 cut(s) 110
BseMII CTCAG 1 cut(s) 363
BseSI GKGCMC 1 cut(s) 351
BsgI GTGCAG 1 cut(s) 163
BshFI GGCC 2 cut(s) 10, 61
BsiHKAI GWGCWC 1 cut(s) 210
BslI CCNNNNNNNGG 1 cut(s) 110
BsnI GGCC 2 cut(s) 10, 61
Bsp1286I GDGCHC 3 cut(s) 210, 281, 351
Bsp143I GATC 4 cut(s) 113, 325, 331, 379
BspANI GGCC 2 cut(s) 10, 61
BspCNI CTCAG 1 cut(s) 364
BspHI TCATGA 1 cut(s) 328
BspPI GGATC 1 cut(s) 121
BssECI CCNNGG 1 cut(s) 18
BssMI GATC 4 cut(s) 113, 325, 331, 379
Bst2UI CCWGG 1 cut(s) 20
BstDEI CTNAG 1 cut(s) 372
BstENI CCTNNNNNAGG 1 cut(s) 108
BstF5I GGATG 3 cut(s) 23, 325, 364
BstKTI GATC 4 cut(s) 116, 328, 334, 382
BstMBI GATC 4 cut(s) 113, 325, 331, 379
BstNI CCWGG 1 cut(s) 20
BstSCI CCNGG 1 cut(s) 18
BstSFI CTRYAG 1 cut(s) 136
BstSLI GKGCMC 1 cut(s) 351
BstX2I RGATCY 1 cut(s) 113
BstYI RGATCY 1 cut(s) 113
BsuRI GGCC 2 cut(s) 10, 61
BtsCI GGATG 3 cut(s) 23, 325, 364
CaiI CAGNNNCTG 1 cut(s) 371
CciI TCATGA 1 cut(s) 328
Cfr13I GGNCC 2 cut(s) 59, 245
Csp6I GTAC 2 cut(s) 133, 147
CviAII CATG 3 cut(s) 81, 251, 329
CviJI RGCY 9 cut(s) 10, 41, 61, 231, 279, 296, 341, 370, 376
CviKI_1 RGCY 9 cut(s) 10, 41, 61, 231, 279, 296, 341, 370, 376
CviQI GTAC 2 cut(s) 133, 147
DdeI CTNAG 1 cut(s) 372
DpnI GATC 4 cut(s) 115, 327, 333, 381
DpnII GATC 4 cut(s) 113, 325, 331, 379
Eco24I GRGCYC 1 cut(s) 281
Eco47I GGWCC 1 cut(s) 245
Eco57I CTGAAG 1 cut(s) 363
EcoNI CCTNNNNNAGG 1 cut(s) 108
EcoO109I RGGNCCY 2 cut(s) 59, 245
EcoRII CCWGG 1 cut(s) 18
EcoT38I GRGCYC 1 cut(s) 281
FaeI CATG 3 cut(s) 84, 254, 332
FaiI YATR 6 cut(s) 82, 93, 212, 252, 330, 423
FatI CATG 3 cut(s) 80, 250, 328
FbaI TGATCA 1 cut(s) 325
FokI GGATG 3 cut(s) 10, 332, 371
FriOI GRGCYC 1 cut(s) 281
HaeIII GGCC 2 cut(s) 10, 61
Hin1II CATG 3 cut(s) 84, 254, 332
HphI GGTGA 1 cut(s) 208
Hpy188I TCNGA 2 cut(s) 48, 70
Hpy188III TCNNGA 2 cut(s) 329, 383
HpyAV CCTTC 4 cut(s) 28, 50, 75, 403
HpyCH4V TGCA 2 cut(s) 144, 304
HpyF3I CTNAG 1 cut(s) 372
Hsp92II CATG 3 cut(s) 84, 254, 332
Ksp22I TGATCA 1 cut(s) 325
Kzo9I GATC 4 cut(s) 113, 325, 331, 379
LpnPI CCDG 8 cut(s) 5, 32, 61, 124, 287, 378, 384, 390
LweI GCATC 2 cut(s) 32, 187
MaeIII GTNAC 1 cut(s) 253
MalI GATC 4 cut(s) 115, 327, 333, 381
MboI GATC 4 cut(s) 113, 325, 331, 379
MboII GAAGA 2 cut(s) 61, 401
MflI RGATCY 1 cut(s) 113
MhlI GDGCHC 3 cut(s) 210, 281, 351
MnlI CCTC 8 cut(s) 72, 78, 122, 236, 258, 268, 310, 349
MspA1I CMGCKG 1 cut(s) 341
MspR9I CCNGG 1 cut(s) 20
MvaI CCWGG 1 cut(s) 20
NdeII GATC 4 cut(s) 113, 325, 331, 379
NlaIII CATG 3 cut(s) 84, 254, 332
NmuCI GTSAC 1 cut(s) 253
PagI TCATGA 1 cut(s) 328
PpuMI RGGWCCY 1 cut(s) 245
Psp5II RGGWCCY 1 cut(s) 245
Psp6I CCWGG 1 cut(s) 18
PspGI CCWGG 1 cut(s) 18
PspPI GGNCC 2 cut(s) 59, 245
PspPPI RGGWCCY 1 cut(s) 245
PstNI CAGNNNCTG 1 cut(s) 371
PsuI RGATCY 1 cut(s) 113
PvuII CAGCTG 1 cut(s) 341
RsaI GTAC 2 cut(s) 134, 148
RsaNI GTAC 2 cut(s) 133, 147
Sau3AI GATC 4 cut(s) 113, 325, 331, 379
Sau96I GGNCC 2 cut(s) 59, 245
ScrFI CCNGG 1 cut(s) 20
SduI GDGCHC 3 cut(s) 210, 281, 351
SetI ASST 8 cut(s) 39, 106, 143, 221, 247, 260, 343, 414
SfaNI GCATC 2 cut(s) 32, 187
SfcI CTRYAG 1 cut(s) 136
SinI GGWCC 1 cut(s) 245
StyD4I CCNGG 1 cut(s) 18
TaqI TCGA 1 cut(s) 241
TatI WGTACW 1 cut(s) 146
TseFI GTSAC 1 cut(s) 253
Tsp45I GTSAC 1 cut(s) 253
TspDTI ATGAA 2 cut(s) 69, 375
VpaK11BI GGWCC 1 cut(s) 245
XagI CCTNNNNNAGG 1 cut(s) 108
XcmI CCANNNNNNNNNTGG 2 cut(s) 34, 175
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.