RLG00000001983

Catalyzes the conversion of 7,8-dihydroneopterin to 6- hydroxymethyl-7,8-dihydropterin

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_laevigata
Chr1
OG0007343
Physical Location & Seq
Reverse (-)
23894010 .. 23895214
1205 bp
Loading structure...
UTR
Exon/CDS
Intron
RLM00000001983

Sequence Viewer

Length: 429 bp
ATGGCTGCTTCTGTGACTGGAACAGCACAGGAAGATGCTGCAATTAGAGGGGGAGATAAGCTTGTACTAAGGGGTTTGAAGTTCCATGGTTTCCATGGGGTGAAGCCAGAAGAAAGGAAGTTGGGTCAGAAGTTTCTGATAGATGTTGATGCTTGGATGGATCTTCGGGTGGCCGGAAAATCTGATCTGTTGTCAGACACCATTAGCTACACCGAAATTTATCGCATTGTAAAAGAGGTTGTAGAAGGGCCACCTCATAATCTTCTAGAGTCTGTTGCTGAACTCATTGCATCCACCACTCTGAAAAACTATCCCCAGATATCTGCTGTCTCTGTGAAAGTTGGAAAGCCTCACGTTGCTGTTCATGGTCCTCTTGATTACTTGGGCGTTGAGATATTTAGATACAGAAGTATTGATGCACCGAACTAA

Protein Analysis

143

Amino Acids

15.55

Weight (kDa)

6.51

Isoelectric Point (pI)

18.95

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
FolB PF02152 22 - 132 3.9e-36 Dihydroneopterin aldolase
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 168
AcoI YGGCCR 1 cut(s) 171
AcsI RAATTY 1 cut(s) 216
AfaI GTAC 1 cut(s) 66
AgsI TTSAA 1 cut(s) 79
AluBI AGCT 2 cut(s) 61, 207
AluI AGCT 2 cut(s) 61, 207
Alw26I GTCTC 1 cut(s) 334
AlwI GGATC 1 cut(s) 168
AoxI GGCC 2 cut(s) 171, 248
ApeKI GCWGC 2 cut(s) 5, 38
ApoI RAATTY 1 cut(s) 216
AspS9I GGNCC 2 cut(s) 248, 368
AsuHPI GGTGA 1 cut(s) 112
AvaII GGWCC 1 cut(s) 368
BaeI ACNNNNGTAYC 2 cut(s) 394, 427
BbvI GCAGC 1 cut(s) 25
BccI CCATC 1 cut(s) 151
BcoDI GTCTC 1 cut(s) 334
BfaI CTAG 1 cut(s) 266
BisI GCNGC 2 cut(s) 6, 39
BlsI GCNGC 2 cut(s) 7, 40
Bme18I GGWCC 1 cut(s) 368
BmgT120I GGNCC 2 cut(s) 248, 368
BmsI GCATC 4 cut(s) 25, 139, 299, 406
BsaJI CCNNGG 2 cut(s) 85, 94
Bse1I ACTGG 1 cut(s) 22
Bse3DI GCAATG 1 cut(s) 285
BseDI CCNNGG 2 cut(s) 85, 94
BseGI GGATG 2 cut(s) 162, 290
BseMI GCAATG 1 cut(s) 285
BseNI ACTGG 1 cut(s) 22
BseXI GCAGC 1 cut(s) 25
BshFI GGCC 2 cut(s) 173, 250
BsiSI CCGG 1 cut(s) 174
BsmAI GTCTC 1 cut(s) 334
BsnI GGCC 2 cut(s) 173, 250
Bsp143I GATC 2 cut(s) 160, 184
Bsp19I CCATGG 2 cut(s) 85, 94
BspANI GGCC 2 cut(s) 173, 250
BspPI GGATC 1 cut(s) 168
BsrDI GCAATG 1 cut(s) 285
BsrI ACTGG 1 cut(s) 22
BssECI CCNNGG 2 cut(s) 85, 94
BssMI GATC 2 cut(s) 160, 184
BssT1I CCWWGG 2 cut(s) 85, 94
BstDEI CTNAG 1 cut(s) 68
BstDSI CCRYGG 2 cut(s) 85, 94
BstF5I GGATG 2 cut(s) 162, 290
BstKTI GATC 2 cut(s) 163, 187
BstMAI GTCTC 1 cut(s) 334
BstMBI GATC 2 cut(s) 160, 184
BstV1I GCAGC 1 cut(s) 25
BstX2I RGATCY 1 cut(s) 160
BstYI RGATCY 1 cut(s) 160
BsuRI GGCC 2 cut(s) 173, 250
BtgI CCRYGG 2 cut(s) 85, 94
BtsCI GGATG 2 cut(s) 162, 290
Cfr13I GGNCC 2 cut(s) 248, 368
Csp6I GTAC 1 cut(s) 65
CviAII CATG 3 cut(s) 86, 95, 365
CviJI RGCY 7 cut(s) 5, 61, 106, 173, 207, 250, 349
CviKI_1 RGCY 7 cut(s) 5, 61, 106, 173, 207, 250, 349
CviQI GTAC 1 cut(s) 65
DdeI CTNAG 1 cut(s) 68
DpnI GATC 2 cut(s) 162, 186
DpnII GATC 2 cut(s) 160, 184
EaeI YGGCCR 1 cut(s) 171
Eco130I CCWWGG 2 cut(s) 85, 94
Eco32I GATATC 1 cut(s) 321
Eco47I GGWCC 1 cut(s) 368
EcoRV GATATC 1 cut(s) 321
EcoT14I CCWWGG 2 cut(s) 85, 94
ErhI CCWWGG 2 cut(s) 85, 94
FaeI CATG 3 cut(s) 89, 98, 368
FaiI YATR 4 cut(s) 87, 96, 258, 366
FatI CATG 3 cut(s) 85, 94, 364
Fnu4HI GCNGC 2 cut(s) 6, 39
FokI GGATG 2 cut(s) 169, 277
Fsp4HI GCNGC 2 cut(s) 6, 39
FspBI CTAG 1 cut(s) 266
GluI GCNGC 2 cut(s) 6, 39
HaeIII GGCC 2 cut(s) 173, 250
HapII CCGG 1 cut(s) 174
Hin1II CATG 3 cut(s) 89, 98, 368
HindIII AAGCTT 1 cut(s) 59
HinfI GANTC 1 cut(s) 269
HpaII CCGG 1 cut(s) 174
HphI GGTGA 1 cut(s) 112
Hpy188I TCNGA 5 cut(s) 129, 138, 184, 196, 303
Hpy188III TCNNGA 2 cut(s) 266, 374
HpyAV CCTTC 1 cut(s) 239
HpyCH4IV ACGT 1 cut(s) 354
HpyCH4V TGCA 3 cut(s) 41, 290, 419
HpyF3I CTNAG 1 cut(s) 68
HpySE526I ACGT 1 cut(s) 354
Hsp92II CATG 3 cut(s) 89, 98, 368
Kzo9I GATC 2 cut(s) 160, 184
LpnPI CCDG 5 cut(s) 3, 14, 120, 187, 329
Lsp1109I GCAGC 1 cut(s) 25
LweI GCATC 4 cut(s) 25, 139, 299, 406
MaeI CTAG 1 cut(s) 266
MaeII ACGT 1 cut(s) 354
MaeIII GTNAC 1 cut(s) 13
MalI GATC 2 cut(s) 162, 186
MboI GATC 2 cut(s) 160, 184
MboII GAAGA 4 cut(s) 44, 122, 155, 254
MflI RGATCY 1 cut(s) 160
MluCI AATT 2 cut(s) 42, 216
MlyI GAGTC 1 cut(s) 278
MmeI TCCRAC 1 cut(s) 322
MnlI CCTC 5 cut(s) 41, 229, 264, 360, 381
MspI CCGG 1 cut(s) 174
NcoI CCATGG 2 cut(s) 85, 94
NdeII GATC 2 cut(s) 160, 184
NlaIII CATG 3 cut(s) 89, 98, 368
NmuCI GTSAC 1 cut(s) 13
PkrI GCNGC 2 cut(s) 7, 40
PleI GAGTC 1 cut(s) 277
PpsI GAGTC 1 cut(s) 277
PspPI GGNCC 2 cut(s) 248, 368
PsuI RGATCY 1 cut(s) 160
RsaI GTAC 1 cut(s) 66
RsaNI GTAC 1 cut(s) 65
SatI GCNGC 2 cut(s) 6, 39
Sau3AI GATC 2 cut(s) 160, 184
Sau96I GGNCC 2 cut(s) 248, 368
SchI GAGTC 1 cut(s) 278
SetI ASST 5 cut(s) 63, 209, 240, 256, 357
SfaNI GCATC 4 cut(s) 25, 139, 299, 406
SinI GGWCC 1 cut(s) 368
Sse9I AATT 2 cut(s) 42, 216
SspMI CTAG 1 cut(s) 266
StyI CCWWGG 2 cut(s) 85, 94
TaiI ACGT 1 cut(s) 357
TasI AATT 2 cut(s) 42, 216
TatI WGTACW 1 cut(s) 64
TseFI GTSAC 1 cut(s) 13
TseI GCWGC 2 cut(s) 5, 38
Tsp45I GTSAC 1 cut(s) 13
TspDTI ATGAA 1 cut(s) 353
VpaK11BI GGWCC 1 cut(s) 368
XapI RAATTY 1 cut(s) 216
XbaI TCTAGA 1 cut(s) 265
XcmI CCANNNNNNNNNTGG 1 cut(s) 92
XspI CTAG 1 cut(s) 266
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.