RLG00000011218

Belongs to the thioredoxin family

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_laevigata
Chr3
OG0004341
Physical Location & Seq
Forward (+)
7762322 .. 7762881
560 bp
Loading structure...
UTR
Exon/CDS
Intron
RLM00000011218

Sequence Viewer

Length: 456 bp
ATGGAATTTGGGGCTGCAGATTTAGGACAAGTTTTGGAATTCAAGAACAGGACCCCTTTGATTGTGGTGGACTTCACTGCTTCATGGTGTGGACCATGCCGTTTCATTGCCCCAATCTTGGCGGAGCTGGCCAGGAAGACCCCGGAGGTCACATTCCTGAAGATGGATGTTGATAAGCTGAAGAAAGTTGCTGAGGACTGGGCTGTGGAGGCAATGCCTACCTTTATGTTCCTTAAAGAAGGCAAGACAAGCTCATCTTTCTTAGCACCACATAAAGGTAGGCATTGCCTCCACACCCCAGTCCTCAGCAACTTTCTTCAGCTCATCAACATCCACCTTCAGGAATGTGACCTCCGGGGCAAGATTGTTGACAAGGTTGTCGGTGCTAAGAAAGATGAGCTTGTGCTCAAAGTAGGCCAGCATGCTGCTGCTGCTGCTGCAACTGCATCTGCTTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
ko04621 ko05418 map04621 map05418
Pfam Domains
Protein Families
Thioredoxin

Protein Analysis

152

Amino Acids

16.56

Weight (kDa)

8.36

Isoelectric Point (pI)

24.72

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Thioredoxin PF00085 16 - 88 1.9e-23 Thioredoxin
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AasI GACNNNNNNGTC 1 cut(s) 377
AciI CCGC 1 cut(s) 122
AcoI YGGCCR 1 cut(s) 129
AcsI RAATTY 2 cut(s) 5, 38
AcuI CTGAAG 4 cut(s) 179, 200, 302, 323
AfiI CCNNNNNNNGG 4 cut(s) 118, 163, 275, 340
AgsI TTSAA 1 cut(s) 43
AjnI CCWGG 1 cut(s) 131
AluBI AGCT 5 cut(s) 127, 178, 252, 322, 400
AluI AGCT 5 cut(s) 127, 178, 252, 322, 400
Alw21I GWGCWC 1 cut(s) 408
AoxI GGCC 2 cut(s) 129, 415
ApeKI GCWGC 6 cut(s) 14, 425, 428, 431, 434, 437
ApoI RAATTY 2 cut(s) 5, 38
AspS9I GGNCC 2 cut(s) 51, 92
AsuC2I CCSGG 2 cut(s) 143, 356
AvaII GGWCC 2 cut(s) 51, 92
BalI TGGCCA 1 cut(s) 131
BbsI GAAGAC 1 cut(s) 143
Bbv12I GWGCWC 1 cut(s) 408
BbvCI CCTCAGC 2 cut(s) 192, 305
BbvI GCAGC 5 cut(s) 412, 415, 418, 421, 424
BccI CCATC 1 cut(s) 157
BceAI ACGGC 1 cut(s) 84
BciT130I CCWGG 1 cut(s) 133
BcnI CCSGG 2 cut(s) 143, 356
BfmI CTRYAG 1 cut(s) 15
BisI GCNGC 6 cut(s) 15, 426, 429, 432, 435, 438
BlsI GCNGC 6 cut(s) 16, 427, 430, 433, 436, 439
Bme1390I CCNGG 3 cut(s) 133, 143, 356
Bme18I GGWCC 2 cut(s) 51, 92
BmgT120I GGNCC 2 cut(s) 51, 92
BmiI GGNNCC 1 cut(s) 53
BmrFI CCNGG 3 cut(s) 133, 143, 356
BmrI ACTGGG 2 cut(s) 208, 293
BmuI ACTGGG 2 cut(s) 208, 293
BpiI GAAGAC 1 cut(s) 143
Bpu10I CCTNAGC 2 cut(s) 192, 305
BpuMI CCSGG 2 cut(s) 143, 356
BsaJI CCNNGG 2 cut(s) 141, 355
Bsc4I CCNNNNNNNGG 4 cut(s) 118, 163, 275, 340
Bse1I ACTGG 2 cut(s) 203, 299
Bse3DI GCAATG 3 cut(s) 105, 219, 283
BseBI CCWGG 1 cut(s) 133
BseDI CCNNGG 2 cut(s) 141, 355
BseGI GGATG 2 cut(s) 172, 330
BseLI CCNNNNNNNGG 4 cut(s) 118, 163, 275, 340
BseMI GCAATG 3 cut(s) 105, 219, 283
BseMII CTCAG 2 cut(s) 183, 319
BseNI ACTGG 2 cut(s) 203, 299
BseXI GCAGC 5 cut(s) 412, 415, 418, 421, 424
BshFI GGCC 2 cut(s) 131, 417
BsiHKAI GWGCWC 1 cut(s) 408
BsiSI CCGG 2 cut(s) 143, 355
BslI CCNNNNNNNGG 4 cut(s) 118, 163, 275, 340
BsnI GGCC 2 cut(s) 131, 417
Bsp1286I GDGCHC 1 cut(s) 408
BspACI CCGC 1 cut(s) 122
BspANI GGCC 2 cut(s) 131, 417
BspCNI CTCAG 2 cut(s) 184, 318
BspLI GGNNCC 1 cut(s) 53
BspMAI CTGCAG 1 cut(s) 19
BsrDI GCAATG 3 cut(s) 105, 219, 283
BsrI ACTGG 2 cut(s) 203, 299
BssECI CCNNGG 2 cut(s) 141, 355
Bst2UI CCWGG 1 cut(s) 133
BstC8I GCNNGC 3 cut(s) 129, 419, 423
BstDEI CTNAG 5 cut(s) 192, 262, 305, 387, 453
BstF5I GGATG 2 cut(s) 172, 330
BstMWI GCNNNNNNNGC 7 cut(s) 128, 209, 249, 431, 434, 437, 443
BstNI CCWGG 1 cut(s) 133
BstNSI RCATGY 1 cut(s) 425
BstSCI CCNGG 3 cut(s) 131, 141, 354
BstSFI CTRYAG 1 cut(s) 15
BstV1I GCAGC 5 cut(s) 412, 415, 418, 421, 424
BstV2I GAAGAC 1 cut(s) 143
BsuRI GGCC 2 cut(s) 131, 417
BtsCI GGATG 2 cut(s) 172, 330
BtsI GCAGTG 1 cut(s) 75
BtsIMutI CAGTG 1 cut(s) 75
Cac8I GCNNGC 3 cut(s) 129, 419, 423
Cfr13I GGNCC 2 cut(s) 51, 92
CviAII CATG 3 cut(s) 84, 96, 422
CviJI RGCY 9 cut(s) 14, 127, 131, 178, 203, 252, 322, 400, 417
CviKI_1 RGCY 9 cut(s) 14, 127, 131, 178, 203, 252, 322, 400, 417
DdeI CTNAG 5 cut(s) 192, 262, 305, 387, 453
DrdI GACNNNNNNGTC 1 cut(s) 377
DseDI GACNNNNNNGTC 1 cut(s) 377
EaeI YGGCCR 1 cut(s) 129
EciI GGCGGA 1 cut(s) 137
Eco47I GGWCC 2 cut(s) 51, 92
Eco57I CTGAAG 4 cut(s) 179, 200, 302, 323
EcoO109I RGGNCCY 1 cut(s) 51
EcoRI GAATTC 1 cut(s) 38
EcoRII CCWGG 1 cut(s) 131
FaeI CATG 3 cut(s) 87, 99, 425
FaiI YATR 5 cut(s) 85, 97, 227, 273, 423
FalI AAGNNNNNCTT 4 cut(s) 241, 273, 384, 416
FatI CATG 3 cut(s) 83, 95, 421
Fnu4HI GCNGC 6 cut(s) 15, 426, 429, 432, 435, 438
FokI GGATG 2 cut(s) 179, 317
Fsp4HI GCNGC 6 cut(s) 15, 426, 429, 432, 435, 438
GluI GCNGC 6 cut(s) 15, 426, 429, 432, 435, 438
HaeIII GGCC 2 cut(s) 131, 417
HapII CCGG 2 cut(s) 143, 355
Hin1II CATG 3 cut(s) 87, 99, 425
HincII GTYRAC 1 cut(s) 370
HindII GTYRAC 1 cut(s) 370
HpaII CCGG 2 cut(s) 143, 355
Hpy166II GTNNAC 3 cut(s) 70, 92, 370
Hpy188III TCNNGA 3 cut(s) 43, 157, 341
Hpy8I GTNNAC 3 cut(s) 70, 92, 370
HpyAV CCTTC 2 cut(s) 233, 347
HpyCH4V TGCA 3 cut(s) 17, 440, 446
HpyF10VI GCNNNNNNNGC 7 cut(s) 128, 209, 249, 431, 434, 437, 443
HpyF3I CTNAG 5 cut(s) 192, 262, 305, 387, 453
Hsp92II CATG 3 cut(s) 87, 99, 425
LmnI GCTCC 1 cut(s) 124
Lsp1109I GCAGC 5 cut(s) 412, 415, 418, 421, 424
MaeIII GTNAC 2 cut(s) 148, 347
MboII GAAGA 4 cut(s) 148, 172, 193, 308
MhlI GDGCHC 1 cut(s) 408
MlsI TGGCCA 1 cut(s) 131
MluCI AATT 2 cut(s) 5, 38
MluNI TGGCCA 1 cut(s) 131
MnlI CCTC 6 cut(s) 139, 187, 202, 299, 314, 362
Mox20I TGGCCA 1 cut(s) 131
MscI TGGCCA 1 cut(s) 131
MseI TTAA 1 cut(s) 234
Msp20I TGGCCA 1 cut(s) 131
MspI CCGG 2 cut(s) 143, 355
MspR9I CCNGG 3 cut(s) 133, 143, 356
MvaI CCWGG 1 cut(s) 133
MwoI GCNNNNNNNGC 7 cut(s) 128, 209, 249, 431, 434, 437, 443
NciI CCSGG 2 cut(s) 143, 356
NlaIII CATG 3 cut(s) 87, 99, 425
NlaIV GGNNCC 1 cut(s) 53
NmuCI GTSAC 2 cut(s) 148, 347
NspI RCATGY 1 cut(s) 425
PaeI GCATGC 1 cut(s) 425
PkrI GCNGC 6 cut(s) 16, 427, 430, 433, 436, 439
PpuMI RGGWCCY 1 cut(s) 51
Psp5II RGGWCCY 1 cut(s) 51
Psp6I CCWGG 1 cut(s) 131
PspGI CCWGG 1 cut(s) 131
PspN4I GGNNCC 1 cut(s) 53
PspPI GGNCC 2 cut(s) 51, 92
PspPPI RGGWCCY 1 cut(s) 51
PstI CTGCAG 1 cut(s) 19
SaqAI TTAA 1 cut(s) 234
SatI GCNGC 6 cut(s) 15, 426, 429, 432, 435, 438
Sau96I GGNCC 2 cut(s) 51, 92
ScrFI CCNGG 3 cut(s) 133, 143, 356
SduI GDGCHC 1 cut(s) 408
SfcI CTRYAG 1 cut(s) 15
SinI GGWCC 2 cut(s) 51, 92
SphI GCATGC 1 cut(s) 425
Sse9I AATT 2 cut(s) 5, 38
SsiI CCGC 1 cut(s) 122
StyD4I CCNGG 3 cut(s) 131, 141, 354
TasI AATT 2 cut(s) 5, 38
Tru1I TTAA 1 cut(s) 234
Tru9I TTAA 1 cut(s) 234
TscAI CASTG 1 cut(s) 82
TseFI GTSAC 2 cut(s) 148, 347
TseI GCWGC 6 cut(s) 14, 425, 428, 431, 434, 437
Tsp45I GTSAC 2 cut(s) 148, 347
TspDTI ATGAA 2 cut(s) 72, 94
TspRI CASTG 1 cut(s) 82
VpaK11BI GGWCC 2 cut(s) 51, 92
XapI RAATTY 2 cut(s) 5, 38
XceI RCATGY 1 cut(s) 425
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.