RLG00000019712

Methyltransferase-like protein

Basic Information

Type: gene
Biological Identity
rosa_laevigata
Chr4
Physical Location & Seq
Reverse (-)
55844328 .. 55878149
33822 bp
Loading structure...
UTR
Exon/CDS
Intron
RLM00000019712

Sequence Viewer

Length: 477 bp
ATGAGTGAAGTACACTTGGGGTGCCCACCTGGTTTCTCTGGCCCTCATATTTCCTACTTCACCTTCTCCATCCCACAACCTGGACCTGGATTGATTGAACCCAGAAGCTCCAATGACTTTTCCCAAGTTGAAGAAGCAACTACTTCCATTTCCACACAGCAAAACATAAGTTTTGACGAGGATGGCGATCTCATTCTTCCTAGACGAAAAACCAAATTGTCTAATCAAATTTATAGCGTGACCATCCAGCATAGTATTACATCAACACTACCAAGTGTTCGTTTGCAGGTGTGGAGAGCAGAACTTGTCTTATTTGATTTTTTATTGCATGCTTATCCGAGCTTGATGGAGTTAATATTGATACATCAAGAGAGTTTAACTACTTTCTATTTTGTATTATTCTTAGCTTTGGAAGAACGCTATAACTTTAGTCTTGATGATCTTGATGTTGTTGCAAATGTCGAAAAGGGATTGTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

159

Amino Acids

17.87

Weight (kDa)

4.73

Isoelectric Point (pI)

55.31

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0011335)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AarI CACCTGC 1 cut(s) 277
Acc36I ACCTGC 1 cut(s) 277
AccB1I GGYRCC 1 cut(s) 21
AccB7I CCANNNNNTGG 1 cut(s) 80
AcsI RAATTY 1 cut(s) 228
AfaI GTAC 1 cut(s) 12
AfiI CCNNNNNNNGG 2 cut(s) 80, 86
AgsI TTSAA 2 cut(s) 98, 131
AjnI CCWGG 3 cut(s) 28, 79, 85
AluBI AGCT 3 cut(s) 108, 342, 407
AluI AGCT 3 cut(s) 108, 342, 407
AoxI GGCC 1 cut(s) 40
ApoI RAATTY 1 cut(s) 228
AspS9I GGNCC 2 cut(s) 41, 83
AsuHPI GGTGA 1 cut(s) 52
AvaII GGWCC 1 cut(s) 83
BaeGI GKGCMC 1 cut(s) 26
BanI GGYRCC 1 cut(s) 21
BccI CCATC 4 cut(s) 77, 176, 251, 340
BciT130I CCWGG 3 cut(s) 30, 81, 87
BfaI CTAG 1 cut(s) 201
BfuAI ACCTGC 1 cut(s) 277
Bme1390I CCNGG 3 cut(s) 30, 81, 87
Bme18I GGWCC 1 cut(s) 83
BmgT120I GGNCC 2 cut(s) 41, 83
BmiI GGNNCC 1 cut(s) 23
BmrFI CCNGG 3 cut(s) 30, 81, 87
BsaBI GATNNNNATC 1 cut(s) 186
Bsc4I CCNNNNNNNGG 2 cut(s) 80, 86
Bse8I GATNNNNATC 1 cut(s) 186
BseBI CCWGG 3 cut(s) 30, 81, 87
BseGI GGATG 3 cut(s) 69, 187, 243
BseJI GATNNNNATC 1 cut(s) 186
BseLI CCNNNNNNNGG 2 cut(s) 80, 86
BseSI GKGCMC 1 cut(s) 26
BshFI GGCC 1 cut(s) 42
BshNI GGYRCC 1 cut(s) 21
BslI CCNNNNNNNGG 2 cut(s) 80, 86
BsnI GGCC 1 cut(s) 42
Bsp1286I GDGCHC 1 cut(s) 26
Bsp143I GATC 2 cut(s) 187, 439
BspANI GGCC 1 cut(s) 42
BspLI GGNNCC 1 cut(s) 23
BspMI ACCTGC 1 cut(s) 277
BspT107I GGYRCC 1 cut(s) 21
BssMI GATC 2 cut(s) 187, 439
Bst2UI CCWGG 3 cut(s) 30, 81, 87
BstC8I GCNNGC 1 cut(s) 330
BstDEI CTNAG 1 cut(s) 403
BstF5I GGATG 3 cut(s) 69, 187, 243
BstKTI GATC 2 cut(s) 190, 442
BstMBI GATC 2 cut(s) 187, 439
BstNI CCWGG 3 cut(s) 30, 81, 87
BstNSI RCATGY 1 cut(s) 332
BstSCI CCNGG 3 cut(s) 28, 79, 85
BstSLI GKGCMC 1 cut(s) 26
BsuRI GGCC 1 cut(s) 42
BtsCI GGATG 3 cut(s) 69, 187, 243
BveI ACCTGC 1 cut(s) 277
Cac8I GCNNGC 1 cut(s) 330
Cfr13I GGNCC 2 cut(s) 41, 83
CsiI ACCWGGT 1 cut(s) 28
Csp6I GTAC 1 cut(s) 11
CviAII CATG 1 cut(s) 329
CviJI RGCY 4 cut(s) 42, 108, 342, 407
CviKI_1 RGCY 4 cut(s) 42, 108, 342, 407
CviQI GTAC 1 cut(s) 11
DdeI CTNAG 1 cut(s) 403
DpnI GATC 2 cut(s) 189, 441
DpnII GATC 2 cut(s) 187, 439
Eco47I GGWCC 1 cut(s) 83
EcoRII CCWGG 3 cut(s) 28, 79, 85
FaeI CATG 1 cut(s) 332
FaiI YATR 6 cut(s) 48, 167, 234, 252, 330, 423
FatI CATG 1 cut(s) 328
FokI GGATG 3 cut(s) 56, 194, 230
FspBI CTAG 1 cut(s) 201
HaeIII GGCC 1 cut(s) 42
Hin1II CATG 1 cut(s) 332
HphI GGTGA 1 cut(s) 52
Hpy166II GTNNAC 1 cut(s) 13
Hpy188I TCNGA 1 cut(s) 339
Hpy188III TCNNGA 3 cut(s) 368, 434, 443
Hpy8I GTNNAC 1 cut(s) 13
HpyAV CCTTC 1 cut(s) 73
HpyCH4V TGCA 3 cut(s) 286, 328, 455
HpyF3I CTNAG 1 cut(s) 403
Hsp92II CATG 1 cut(s) 332
Kzo9I GATC 2 cut(s) 187, 439
LmnI GCTCC 1 cut(s) 113
MabI ACCWGGT 1 cut(s) 28
MaeI CTAG 1 cut(s) 201
MaeIII GTNAC 1 cut(s) 238
MalI GATC 2 cut(s) 189, 441
MboI GATC 2 cut(s) 187, 439
MboII GAAGA 3 cut(s) 143, 188, 425
MhlI GDGCHC 1 cut(s) 26
MluCI AATT 2 cut(s) 215, 228
MnlI CCTC 2 cut(s) 54, 172
MseI TTAA 2 cut(s) 353, 377
MspR9I CCNGG 3 cut(s) 30, 81, 87
MvaI CCWGG 3 cut(s) 30, 81, 87
NdeII GATC 2 cut(s) 187, 439
NlaIII CATG 1 cut(s) 332
NlaIV GGNNCC 1 cut(s) 23
NmuCI GTSAC 1 cut(s) 238
NspI RCATGY 1 cut(s) 332
PaeI GCATGC 1 cut(s) 332
PaqCI CACCTGC 1 cut(s) 277
PcsI WCGNNNNNNNCGW 1 cut(s) 183
PflMI CCANNNNNTGG 1 cut(s) 80
Psp6I CCWGG 3 cut(s) 28, 79, 85
PspGI CCWGG 3 cut(s) 28, 79, 85
PspN4I GGNNCC 1 cut(s) 23
PspPI GGNCC 2 cut(s) 41, 83
RsaI GTAC 1 cut(s) 12
RsaNI GTAC 1 cut(s) 11
SaqAI TTAA 2 cut(s) 353, 377
Sau3AI GATC 2 cut(s) 187, 439
Sau96I GGNCC 2 cut(s) 41, 83
ScrFI CCNGG 3 cut(s) 30, 81, 87
SduI GDGCHC 1 cut(s) 26
SetI ASST 8 cut(s) 31, 65, 82, 88, 110, 291, 344, 409
SexAI ACCWGGT 1 cut(s) 28
SinI GGWCC 1 cut(s) 83
SphI GCATGC 1 cut(s) 332
Sse9I AATT 2 cut(s) 215, 228
SspI AATATT 1 cut(s) 357
SspMI CTAG 1 cut(s) 201
StyD4I CCNGG 3 cut(s) 28, 79, 85
TaqI TCGA 1 cut(s) 462
TasI AATT 2 cut(s) 215, 228
TatI WGTACW 1 cut(s) 10
Tru1I TTAA 2 cut(s) 353, 377
Tru9I TTAA 2 cut(s) 353, 377
TseFI GTSAC 1 cut(s) 238
Tsp45I GTSAC 1 cut(s) 238
Van91I CCANNNNNTGG 1 cut(s) 80
VpaK11BI GGWCC 1 cut(s) 83
XapI RAATTY 1 cut(s) 228
XceI RCATGY 1 cut(s) 332
XspI CTAG 1 cut(s) 201
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.