Rorug02G0348800

Methyltransferase-like protein

Basic Information

Type: gene
Biological Identity
rosa_rugosa
GWHBQTZ00000002
Physical Location & Seq
Forward (+)
43744829 .. 43745008
180 bp
Loading structure...
UTR
Exon/CDS
Intron
Rorug02G0348800.1

Sequence Viewer

Length: 180 bp
ATGAACAACACATTTAGATCTTGGAAAGGCAAATTGCACAAGCACTTCAAAAAATATGCTAATGACATTGATTATGCAAGGGCTCACCCTCCCAATGACAAAGTGTTTGGTGATAGGGAGATAAGTGATTGGGAGTGGCTGTGTGATAATTTGTACACAGATCAAGCATATCAGGTATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

59

Amino Acids

7.18

Weight (kDa)

6.81

Isoelectric Point (pI)

21.89

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0011335)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AfaI GTAC 1 cut(s) 155
AgsI TTSAA 1 cut(s) 49
ArsI GACNNNNNNTTYG 2 cut(s) 89, 121
AsuHPI GGTGA 2 cut(s) 77, 122
BanII GRGCYC 1 cut(s) 85
BglII AGATCT 1 cut(s) 17
BsaXI ACNNNNNCTCC 2 cut(s) 125, 155
Bsp1286I GDGCHC 1 cut(s) 85
Bsp1407I TGTACA 1 cut(s) 153
Bsp143I GATC 2 cut(s) 17, 160
BsrGI TGTACA 1 cut(s) 153
BssMI GATC 2 cut(s) 17, 160
BstAUI TGTACA 1 cut(s) 153
BstKTI GATC 2 cut(s) 20, 163
BstMBI GATC 2 cut(s) 17, 160
BstX2I RGATCY 1 cut(s) 17
BstYI RGATCY 1 cut(s) 17
Csp6I GTAC 1 cut(s) 154
CviJI RGCY 2 cut(s) 83, 139
CviKI_1 RGCY 2 cut(s) 83, 139
CviQI GTAC 1 cut(s) 154
DpnI GATC 2 cut(s) 19, 162
DpnII GATC 2 cut(s) 17, 160
Eco24I GRGCYC 1 cut(s) 85
EcoT38I GRGCYC 1 cut(s) 85
FaiI YATR 4 cut(s) 57, 75, 169, 178
FriOI GRGCYC 1 cut(s) 85
HphI GGTGA 2 cut(s) 77, 122
Hpy166II GTNNAC 1 cut(s) 156
Hpy8I GTNNAC 1 cut(s) 156
HpyCH4V TGCA 2 cut(s) 37, 77
Kzo9I GATC 2 cut(s) 17, 160
LpnPI CCDG 1 cut(s) 158
MalI GATC 2 cut(s) 19, 162
MboI GATC 2 cut(s) 17, 160
MflI RGATCY 1 cut(s) 17
MhlI GDGCHC 1 cut(s) 85
MluCI AATT 2 cut(s) 32, 148
MnlI CCTC 1 cut(s) 99
NdeII GATC 2 cut(s) 17, 160
PsuI RGATCY 1 cut(s) 17
RsaI GTAC 1 cut(s) 155
RsaNI GTAC 1 cut(s) 154
Sau3AI GATC 2 cut(s) 17, 160
SduI GDGCHC 1 cut(s) 85
SetI ASST 1 cut(s) 177
SgeI CNNG 4 cut(s) 33, 52, 90, 176
Sse9I AATT 2 cut(s) 32, 148
TasI AATT 2 cut(s) 32, 148
TatI WGTACW 1 cut(s) 153
TspDTI ATGAA 1 cut(s) 17
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.