RLG00000026571

No description available

Basic Information

Type: gene
Biological Identity
rosa_laevigata
Chr6
Physical Location & Seq
Reverse (-)
3920602 .. 3921415
814 bp
Loading structure...
UTR
Exon/CDS
Intron
RLM00000026571

Sequence Viewer

Length: 315 bp
ATGTGGATTGAAGATAAAGCTCAATGTCGGCCATTAAAAAATGAAATAGATTTAAAGACCGCCGATTTGAGACCACGAAATTTGAAGTTTTCAAACTTGATAACGAAAACTGTGAGTGAACAAAGAGCTTTTCTTGTTCGCAAGTGGAATTCCTTAATCAGGAAAGAGGATGATACTGCATTGATCAAGAGCATCGGTGCTCTGAGTGATGATACTACATTGATCAAGAGAACCGGTGCTCTGAGTGATGATCTTGCCATCTTGCAAGAGATTTTGGATGGTGTGATTCAATGGTGGGATGACATTGCCCTATAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

105

Amino Acids

11.94

Weight (kDa)

5.4

Isoelectric Point (pI)

32.49

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 60
AcoI YGGCCR 1 cut(s) 29
AcsI RAATTY 2 cut(s) 79, 148
AfiI CCNNNNNNNGG 1 cut(s) 159
AgeI ACCGGT 1 cut(s) 233
AgsI TTSAA 4 cut(s) 11, 85, 93, 290
AluBI AGCT 2 cut(s) 20, 128
AluI AGCT 2 cut(s) 20, 128
Alw21I GWGCWC 2 cut(s) 202, 241
Alw26I GTCTC 1 cut(s) 64
AoxI GGCC 1 cut(s) 29
ApoI RAATTY 2 cut(s) 79, 148
ArsI GACNNNNNNTTYG 2 cut(s) 49, 81
AsiGI ACCGGT 1 cut(s) 233
Bbv12I GWGCWC 2 cut(s) 202, 241
BccI CCATC 2 cut(s) 266, 272
BclI TGATCA 2 cut(s) 183, 222
BcoDI GTCTC 1 cut(s) 64
BfmI CTRYAG 1 cut(s) 311
BmsI GCATC 1 cut(s) 201
BsaI GGTCTC 1 cut(s) 64
BsaWI WCCGGW 1 cut(s) 233
Bsc4I CCNNNNNNNGG 1 cut(s) 159
Bse118I RCCGGY 1 cut(s) 233
Bse3DI GCAATG 1 cut(s) 303
BseGI GGATG 3 cut(s) 175, 283, 304
BseLI CCNNNNNNNGG 1 cut(s) 159
BseMI GCAATG 1 cut(s) 303
BseMII CTCAG 2 cut(s) 194, 233
BshFI GGCC 1 cut(s) 31
BshTI ACCGGT 1 cut(s) 233
BsiHKAI GWGCWC 2 cut(s) 202, 241
BsiSI CCGG 1 cut(s) 234
BslI CCNNNNNNNGG 1 cut(s) 159
BsmAI GTCTC 1 cut(s) 64
BsnI GGCC 1 cut(s) 31
Bso31I GGTCTC 1 cut(s) 64
Bsp1286I GDGCHC 2 cut(s) 202, 241
Bsp143I GATC 3 cut(s) 183, 222, 250
BspACI CCGC 1 cut(s) 60
BspANI GGCC 1 cut(s) 31
BspCNI CTCAG 2 cut(s) 195, 234
BspTNI GGTCTC 1 cut(s) 64
BsrDI GCAATG 1 cut(s) 303
BsrFI RCCGGY 1 cut(s) 233
BssAI RCCGGY 1 cut(s) 233
BssMI GATC 3 cut(s) 183, 222, 250
Bst4CI ACNGT 1 cut(s) 112
BstDEI CTNAG 2 cut(s) 203, 242
BstENI CCTNNNNNAGG 1 cut(s) 157
BstF5I GGATG 3 cut(s) 175, 283, 304
BstKTI GATC 3 cut(s) 186, 225, 253
BstMAI GTCTC 1 cut(s) 64
BstMBI GATC 3 cut(s) 183, 222, 250
BstSFI CTRYAG 1 cut(s) 311
BsuRI GGCC 1 cut(s) 31
BtsCI GGATG 3 cut(s) 175, 283, 304
Cfr10I RCCGGY 1 cut(s) 233
CspAI ACCGGT 1 cut(s) 233
CspCI CAANNNNNGTGG 2 cut(s) 63, 98
CviJI RGCY 3 cut(s) 20, 31, 128
CviKI_1 RGCY 3 cut(s) 20, 31, 128
DdeI CTNAG 2 cut(s) 203, 242
DpnI GATC 3 cut(s) 185, 224, 252
DpnII GATC 3 cut(s) 183, 222, 250
DraI TTTAAA 1 cut(s) 54
EaeI YGGCCR 1 cut(s) 29
Eco31I GGTCTC 1 cut(s) 64
EcoNI CCTNNNNNAGG 1 cut(s) 157
EcoRI GAATTC 1 cut(s) 148
FaiI YATR 1 cut(s) 313
FbaI TGATCA 2 cut(s) 183, 222
FokI GGATG 3 cut(s) 182, 290, 311
HaeIII GGCC 1 cut(s) 31
HapII CCGG 1 cut(s) 234
HinfI GANTC 1 cut(s) 286
HpaII CCGG 1 cut(s) 234
Hpy166II GTNNAC 1 cut(s) 119
Hpy188I TCNGA 2 cut(s) 204, 243
Hpy188III TCNNGA 3 cut(s) 160, 187, 226
Hpy8I GTNNAC 1 cut(s) 119
HpyCH4III ACNGT 1 cut(s) 112
HpyCH4V TGCA 2 cut(s) 179, 265
HpyF3I CTNAG 2 cut(s) 203, 242
Ksp22I TGATCA 2 cut(s) 183, 222
Kzo9I GATC 3 cut(s) 183, 222, 250
LpnPI CCDG 2 cut(s) 145, 247
LweI GCATC 1 cut(s) 201
MalI GATC 3 cut(s) 185, 224, 252
MboI GATC 3 cut(s) 183, 222, 250
MboII GAAGA 1 cut(s) 23
MhlI GDGCHC 2 cut(s) 202, 241
MluCI AATT 2 cut(s) 79, 148
MnlI CCTC 1 cut(s) 160
MseI TTAA 3 cut(s) 35, 53, 155
MspI CCGG 1 cut(s) 234
NdeII GATC 3 cut(s) 183, 222, 250
PfeI GAWTC 1 cut(s) 286
PinAI ACCGGT 1 cut(s) 233
SaqAI TTAA 3 cut(s) 35, 53, 155
Sau3AI GATC 3 cut(s) 183, 222, 250
SduI GDGCHC 2 cut(s) 202, 241
SetI ASST 2 cut(s) 22, 130
SfaNI GCATC 1 cut(s) 201
SfcI CTRYAG 1 cut(s) 311
Sse9I AATT 2 cut(s) 79, 148
SsiI CCGC 1 cut(s) 60
TaaI ACNGT 1 cut(s) 112
TasI AATT 2 cut(s) 79, 148
TfiI GAWTC 1 cut(s) 286
Tru1I TTAA 3 cut(s) 35, 53, 155
Tru9I TTAA 3 cut(s) 35, 53, 155
TspDTI ATGAA 1 cut(s) 57
XagI CCTNNNNNAGG 1 cut(s) 157
XapI RAATTY 2 cut(s) 79, 148
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.