Basic Information

Type: gene

Biological Identity

Species

rosa_laevigata

Chromosome

Chr6

Orthogroup ID

OG0004334

Physical Location & Seq

Genomic Coordinates Forward (+)

8291663 .. 8293179

Gene Structure 1517 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

RLM00000027086

Sequence Viewer

CDS Protein Promoter (2k)

Length: 645 bp

ATGGAATCACATAAGACCATGATGAGTCAGCTTGGAACCCCAAAGGCTCGTCCGACTGCACTCAAATCTAGACTAGCAAACCCCCAGCCAGAGCCTGCTGCTAGGAGCAACTTAATATCTAAACAATCAGCTTCTTCCCCTGGATTGAATTCTTCAAGTTCAGGTATCTGGAGGCCCTCATCATCTGGGGGACGAGGATCAAGACCTGCAACACCAACTGGACCCCCCACAGTGACTTCAGCTCCTAAACATTCAAGATCGTCAACACCTACTTCTCGAGCAACACTAACCAAGTCCACGATCCTCTACACCGTCAAGGTCTACGGCATAAATATGAGGAAACTGGCTCCCCCCAAGCACGATGACAAACAATCTCCTCGTGGTAACCACTCTGGGGAGTCATCTTCATTCCCAGACAGTTCAGGCTTTGGTAGATCACTCTCAAAGAAATCCCTTGATATGGCTATATGTCACATGGATATAAGAACTGTTAGTGTTTCAGATTCTCCTCTTGCCACCAGCAGTAATGCTGGCTCTGAAGTCAGTGTAAACAACATTGGCCTTTGTTTAGATGCGACTGGAGTAGAAGATGATATTGGCAGTGAGAGAGGTGGTCGATCTCCTGCCAGTGTGCATGGTAGGTGA

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

No domains found.

Protein Analysis

215

Amino Acids

22.3

Weight (kDa)

10.24

Isoelectric Point (pI)

68.98

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0004334)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT2G40070 AT2G40070 AT2G40070
fragaria_vesca	FvH4_7g24310 FvH4_7g24310 FvH4_7g24320 FvH4_7g24320
malus_domestica	MD01G1132400.v1.1 MD07G1220000.v1.1 MD07G1220200.v1.1
prunus_persica	Prupe.2G248600_v2.0.a1 Prupe.2G248600_v2.0.a1
pyrus_communis	pycom01g16900 pycom07g19910
rosa_chinensis	RchiOBHm_Chr1g0369941 RchiOBHm_Chr1g0369981
rosa_laevigata	RLG00000027081 RLG00000027086
rosa_multiflora	Rmu_co8421201.1_g000001 Rmu_co8476543.1_g000001 Rmu_sc0008140.1_g000014 Rmu_sc0008140.1_g000020
rosa_roxburghii	Rroxscaffold_4G00286910 Rroxscaffold_4G00287130
rosa_rugosa	Rorug01G0352900
rosa_samantha	Rh1AG361700 Rh1AG361800 Rh1BG325000 Rh1CG338200 Rh1CG338300 Rh1DG355400
rosa_wichuraiana	Rw1G031830

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
Acc36I	ACCTGC	1 cut(s)	214
AccI	GTMKAC	1 cut(s)	321
AclWI	GGATC	2 cut(s)	205, 295
AcsI	RAATTY	1 cut(s)	148
AcuI	CTGAAG	2 cut(s)	222, 558
AfiI	CCNNNNNNNGG	2 cut(s)	394, 460
AgsI	TTSAA	3 cut(s)	148, 156, 255
AjnI	CCWGG	1 cut(s)	139
AjuI	GAANNNNNNNTTGG	2 cut(s)	579, 611
AluBI	AGCT	3 cut(s)	31, 131, 242
AluI	AGCT	3 cut(s)	31, 131, 242
AlwI	GGATC	2 cut(s)	205, 295
AlwNI	CAGNNNCTG	1 cut(s)	95
Ama87I	CYCGRG	1 cut(s)	276
AoxI	GGCC	2 cut(s)	173, 559
ApeKI	GCWGC	1 cut(s)	98
ApoI	RAATTY	1 cut(s)	148
AspS9I	GGNCC	2 cut(s)	174, 221
AvaI	CYCGRG	1 cut(s)	276
AvaII	GGWCC	1 cut(s)	221
BauI	CACGAG	1 cut(s)	378
BbvI	GCAGC	1 cut(s)	85
BceAI	ACGGC	1 cut(s)	340
BciT130I	CCWGG	1 cut(s)	141
BfaI	CTAG	3 cut(s)	69, 74, 102
BfuAI	ACCTGC	1 cut(s)	214
BisI	GCNGC	1 cut(s)	99
BlsI	GCNGC	1 cut(s)	100
Bme1390I	CCNGG	1 cut(s)	141
Bme18I	GGWCC	1 cut(s)	221
BmeT110I	CYCGRG	1 cut(s)	276
BmgT120I	GGNCC	2 cut(s)	174, 221
BmiI	GGNNCC	3 cut(s)	37, 223, 348
BmrFI	CCNGG	1 cut(s)	141
BmsI	GCATC	1 cut(s)	562
BpmI	CTGGAG	2 cut(s)	190, 600
BsaJI	CCNNGG	1 cut(s)	139
BsaXI	ACNNNNNCTCC	2 cut(s)	226, 256
Bsc4I	CCNNNNNNNGG	2 cut(s)	394, 460
Bse1I	ACTGG	4 cut(s)	223, 348, 583, 627
BseBI	CCWGG	1 cut(s)	141
BseDI	CCNNGG	1 cut(s)	139
BseLI	CCNNNNNNNGG	2 cut(s)	394, 460
BseNI	ACTGG	4 cut(s)	223, 348, 583, 627
BseRI	GAGGAG	2 cut(s)	366, 498
BseXI	GCAGC	1 cut(s)	85
BseYI	CCCAGC	1 cut(s)	84
BsgI	GTGCAG	1 cut(s)	42
BshFI	GGCC	2 cut(s)	175, 561
BsiHKCI	CYCGRG	1 cut(s)	276
BslFI	GGGAC	1 cut(s)	204
BslI	CCNNNNNNNGG	2 cut(s)	394, 460
BsmFI	GGGAC	1 cut(s)	204
BsnI	GGCC	2 cut(s)	175, 561
BsoBI	CYCGRG	1 cut(s)	276
Bsp143I	GATC	5 cut(s)	197, 257, 300, 434, 617
BspANI	GGCC	2 cut(s)	175, 561
BspLI	GGNNCC	3 cut(s)	37, 223, 348
BspMI	ACCTGC	1 cut(s)	214
BspPI	GGATC	2 cut(s)	205, 295
BsrI	ACTGG	4 cut(s)	223, 348, 583, 627
BssECI	CCNNGG	1 cut(s)	139
BssMI	GATC	5 cut(s)	197, 257, 300, 434, 617
BssSI	CACGAG	1 cut(s)	378
Bst2BI	CACGAG	1 cut(s)	378
Bst2UI	CCWGG	1 cut(s)	141
Bst4CI	ACNGT	4 cut(s)	232, 313, 419, 490
BstC8I	GCNNGC	2 cut(s)	96, 532
BstEII	GGTNACC	1 cut(s)	383
BstKTI	GATC	5 cut(s)	200, 260, 303, 437, 620
BstMBI	GATC	5 cut(s)	197, 257, 300, 434, 617
BstNI	CCWGG	1 cut(s)	141
BstPI	GGTNACC	1 cut(s)	383
BstSCI	CCNGG	1 cut(s)	139
BstV1I	GCAGC	1 cut(s)	85
BsuRI	GGCC	2 cut(s)	175, 561
BtsI	GCAGTG	1 cut(s)	607
BtsIMutI	CAGTG	4 cut(s)	237, 550, 607, 634
BveI	ACCTGC	1 cut(s)	214
Cac8I	GCNNGC	2 cut(s)	96, 532
CaiI	CAGNNNCTG	1 cut(s)	95
Cfr13I	GGNCC	2 cut(s)	174, 221
CviAII	CATG	3 cut(s)	19, 475, 635
DpnI	GATC	5 cut(s)	199, 259, 302, 436, 619
DpnII	GATC	5 cut(s)	197, 257, 300, 434, 617
Eco47I	GGWCC	1 cut(s)	221
Eco57I	CTGAAG	2 cut(s)	222, 558
Eco88I	CYCGRG	1 cut(s)	276
Eco91I	GGTNACC	1 cut(s)	383
EcoO109I	RGGNCCY	1 cut(s)	174
EcoO65I	GGTNACC	1 cut(s)	383
EcoRI	GAATTC	1 cut(s)	148
EcoRII	CCWGG	1 cut(s)	139
FaeI	CATG	3 cut(s)	22, 478, 638
FaqI	GGGAC	1 cut(s)	204
FatI	CATG	3 cut(s)	18, 474, 634
FblI	GTMKAC	1 cut(s)	321
Fnu4HI	GCNGC	1 cut(s)	99
Fsp4HI	GCNGC	1 cut(s)	99
FspBI	CTAG	3 cut(s)	69, 74, 102
GluI	GCNGC	1 cut(s)	99
GsaI	CCCAGC	1 cut(s)	88
GsuI	CTGGAG	2 cut(s)	190, 600
HaeIII	GGCC	2 cut(s)	175, 561
Hin1II	CATG	3 cut(s)	22, 478, 638
HincII	GTYRAC	1 cut(s)	264
HindII	GTYRAC	1 cut(s)	264
HinfI	GANTC	4 cut(s)	5, 25, 398, 503
Hpy166II	GTNNAC	4 cut(s)	264, 297, 322, 550
Hpy188I	TCNGA	3 cut(s)	54, 502, 538
Hpy188III	TCNNGA	5 cut(s)	69, 169, 201, 255, 276
Hpy8I	GTNNAC	4 cut(s)	264, 297, 322, 550
HpyCH4III	ACNGT	4 cut(s)	232, 313, 419, 490
HpyCH4V	TGCA	3 cut(s)	59, 209, 634
Hsp92II	CATG	3 cut(s)	22, 478, 638
Kzo9I	GATC	5 cut(s)	197, 257, 300, 434, 617
LmnI	GCTCC	3 cut(s)	105, 247, 352
Lsp1109I	GCAGC	1 cut(s)	85
LweI	GCATC	1 cut(s)	562
MaeI	CTAG	3 cut(s)	69, 74, 102
MaeIII	GTNAC	3 cut(s)	232, 383, 470
MalI	GATC	5 cut(s)	199, 259, 302, 436, 619
MboI	GATC	5 cut(s)	197, 257, 300, 434, 617
MboII	GAAGA	4 cut(s)	126, 144, 396, 599
MluCI	AATT	1 cut(s)	148
MlyI	GAGTC	2 cut(s)	34, 407
MmeI	TCCRAC	1 cut(s)	77
MnlI	CCTC	8 cut(s)	165, 187, 188, 314, 330, 387, 519, 602
MseI	TTAA	1 cut(s)	113
MslI	CAYNNNNRTG	1 cut(s)	332
MspR9I	CCNGG	1 cut(s)	141
MvaI	CCWGG	1 cut(s)	141
NdeII	GATC	5 cut(s)	197, 257, 300, 434, 617
NlaIII	CATG	3 cut(s)	22, 478, 638
NlaIV	GGNNCC	3 cut(s)	37, 223, 348
NmuCI	GTSAC	2 cut(s)	232, 470
PaeR7I	CTCGAG	1 cut(s)	276
PfeI	GAWTC	2 cut(s)	5, 503
PkrI	GCNGC	1 cut(s)	100
PleI	GAGTC	2 cut(s)	33, 406
PpsI	GAGTC	2 cut(s)	33, 406
Psp6I	CCWGG	1 cut(s)	139
PspEI	GGTNACC	1 cut(s)	383
PspFI	CCCAGC	1 cut(s)	84
PspGI	CCWGG	1 cut(s)	139
PspN4I	GGNNCC	3 cut(s)	37, 223, 348
PspPI	GGNCC	2 cut(s)	174, 221
PstNI	CAGNNNCTG	1 cut(s)	95
RseI	CAYNNNNRTG	1 cut(s)	332
SaqAI	TTAA	1 cut(s)	113
SatI	GCNGC	1 cut(s)	99
Sau3AI	GATC	5 cut(s)	197, 257, 300, 434, 617
Sau96I	GGNCC	2 cut(s)	174, 221
SchI	GAGTC	2 cut(s)	34, 407
ScrFI	CCNGG	1 cut(s)	141
SetI	ASST	9 cut(s)	33, 133, 166, 208, 244, 271, 321, 613, 644
SfaNI	GCATC	1 cut(s)	562
Sfr274I	CTCGAG	1 cut(s)	276
SinI	GGWCC	1 cut(s)	221
SlaI	CTCGAG	1 cut(s)	276
SmiMI	CAYNNNNRTG	1 cut(s)	332
SmlI	CTYRAG	1 cut(s)	276
SmoI	CTYRAG	1 cut(s)	276
Sse9I	AATT	1 cut(s)	148
SspMI	CTAG	3 cut(s)	69, 74, 102
StyD4I	CCNGG	1 cut(s)	139
TaaI	ACNGT	4 cut(s)	232, 313, 419, 490
TaqI	TCGA	2 cut(s)	277, 616
TasI	AATT	1 cut(s)	148
TfiI	GAWTC	2 cut(s)	5, 503
Tru1I	TTAA	1 cut(s)	113
Tru9I	TTAA	1 cut(s)	113
TscAI	CASTG	4 cut(s)	237, 550, 607, 634
TseFI	GTSAC	2 cut(s)	232, 470
TseI	GCWGC	1 cut(s)	98
Tsp45I	GTSAC	2 cut(s)	232, 470
TspDTI	ATGAA	1 cut(s)	396
TspRI	CASTG	4 cut(s)	237, 550, 607, 634
VpaK11BI	GGWCC	1 cut(s)	221
XapI	RAATTY	1 cut(s)	148
XbaI	TCTAGA	1 cut(s)	68
XhoI	CTCGAG	1 cut(s)	276
XmiI	GTMKAC	1 cut(s)	321
XspI	CTAG	3 cut(s)	69, 74, 102

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.