Basic Information

Type: gene

Biological Identity

Species

rosa_laevigata

Chromosome

Chr6

Orthogroup ID

OG0014799

Physical Location & Seq

Genomic Coordinates Forward (+)

21529552 .. 21533682

Gene Structure 4131 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

RLM00000028334

Sequence Viewer

CDS Protein Promoter (2k)

Length: 615 bp

ATGGCCACTGGAGATCCTTGGAGGGGAAATTACCACGCAGGGGCCTCTTTTCTCAAACATATGGAGAAATCAGATTCTGTTCCTCCAATCCCCAACAATCTTTCTTCTTATGGGAAACAATTTTTTAGACGATGTCTGCAAAGGGAACCAAATTTGAGGGCATCTGCATCCCAGTTGCTTGAGGATCCATTCATAACCAGGCCAAACTTCAGGCACCCATCTGGAGCTGGTACAATTGTTGGAGCTGTTGCTGCCCCCATCATTCACCAGCAGCACGTAGTTACCCCAGCTGCTCCCAAGCAACACATTGTTACCCCTGCTGCTCCCAAGCACCAGCTTGTTTTCCCCGCTGCTGCTCCCAAGCAATGGCTTGTTATCCCCGCTGCTGCTCCCAAGCAATGGCTTGTTATCCCCGCTGCTGCTCCTAAGCAACGGTTTTTTATCCCCGCTGCTCCCAAGCAACGGTTTTTTATCCCCGCTGCTCCCAAGCAACGGCTTGTTATCCCCGCTACTCCCAAGCAACTCGTTGTTATCCCCGCTTCTCCCAAGCAACTCGTTGTTATCCCGCTGCTCCCTCCCAAGCAACACATGGTTACCCTTGTTGCTCCCAAGTAG

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

Pkinase

Protein Analysis

205

Amino Acids

22.27

Weight (kDa)

11.11

Isoelectric Point (pI)

57.14

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0014799)

Species	Orthologous Gene IDs
fragaria_vesca	FvH4_7g13230 FvH4_7g13230 FvH4_7g13230 FvH4_7g13230
rosa_chinensis	RchiOBHm_Chr1g0352391
rosa_laevigata	RLG00000028334
rosa_roxburghii	Rroxscaffold_166G00440730 Rroxscaffold_4G00302910
rosa_rugosa	Rorug01G0228400 Rorug01G0228400
rosa_samantha	Rh1AG241600 Rh1AG241700 Rh1BG212900 Rh1CG225500 Rh1DG239200 Rh3BG095500
rosa_wichuraiana	Rw1G020930

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AccB1I	GGYRCC	1 cut(s)	213
AccB7I	CCANNNNNTGG	2 cut(s)	366, 399
AciI	CCGC	8 cut(s)	348, 381, 414, 447, 477, 507, 537, 566
AclWI	GGATC	3 cut(s)	8, 179, 192
AcoI	YGGCCR	1 cut(s)	3
AcsI	RAATTY	1 cut(s)	151
AcuI	CTGAAG	1 cut(s)	193
AfaI	GTAC	1 cut(s)	232
AfiI	CCNNNNNNNGG	6 cut(s)	23, 40, 366, 399, 462, 492
AjnI	CCWGG	1 cut(s)	197
AluBI	AGCT	4 cut(s)	227, 245, 290, 337
AluI	AGCT	4 cut(s)	227, 245, 290, 337
AlwI	GGATC	3 cut(s)	8, 179, 192
AlwNI	CAGNNNCTG	1 cut(s)	77
AoxI	GGCC	3 cut(s)	3, 42, 200
ApoI	RAATTY	1 cut(s)	151
AspS9I	GGNCC	1 cut(s)	42
AsuHPI	GGTGA	1 cut(s)	257
BaeI	ACNNNNGTAYC	2 cut(s)	222, 255
BalI	TGGCCA	1 cut(s)	5
BamHI	GGATCC	1 cut(s)	184
BanI	GGYRCC	1 cut(s)	213
BccI	CCATC	2 cut(s)	226, 266
BceAI	ACGGC	1 cut(s)	509
BciT130I	CCWGG	1 cut(s)	199
Bme1390I	CCNGG	1 cut(s)	199
BmgT120I	GGNCC	1 cut(s)	42
BmiI	GGNNCC	4 cut(s)	43, 147, 186, 215
BmrFI	CCNGG	1 cut(s)	199
BmrI	ACTGGG	1 cut(s)	166
BmsI	GCATC	2 cut(s)	170, 176
BmuI	ACTGGG	1 cut(s)	166
BpmI	CTGGAG	2 cut(s)	30, 243
Bpu10I	CCTNAGC	1 cut(s)	426
BpuEI	CTTGAG	1 cut(s)	200
BsaAI	YACGTR	1 cut(s)	277
BsaJI	CCNNGG	1 cut(s)	17
Bsc4I	CCNNNNNNNGG	6 cut(s)	23, 40, 366, 399, 462, 492
Bse1I	ACTGG	2 cut(s)	13, 172
Bse3DI	GCAATG	2 cut(s)	371, 404
BseBI	CCWGG	1 cut(s)	199
BseDI	CCNNGG	1 cut(s)	17
BseGI	GGATG	1 cut(s)	167
BseLI	CCNNNNNNNGG	6 cut(s)	23, 40, 366, 399, 462, 492
BseMI	GCAATG	2 cut(s)	371, 404
BseNI	ACTGG	2 cut(s)	13, 172
BseYI	CCCAGC	1 cut(s)	286
BshFI	GGCC	3 cut(s)	5, 44, 202
BshNI	GGYRCC	1 cut(s)	213
BslI	CCNNNNNNNGG	6 cut(s)	23, 40, 366, 399, 462, 492
BsnI	GGCC	3 cut(s)	5, 44, 202
Bsp143I	GATC	2 cut(s)	13, 184
BspACI	CCGC	8 cut(s)	348, 381, 414, 447, 477, 507, 537, 566
BspANI	GGCC	3 cut(s)	5, 44, 202
BspLI	GGNNCC	4 cut(s)	43, 147, 186, 215
BspPI	GGATC	3 cut(s)	8, 179, 192
BspT107I	GGYRCC	1 cut(s)	213
BsrDI	GCAATG	2 cut(s)	371, 404
BsrI	ACTGG	2 cut(s)	13, 172
BssECI	CCNNGG	1 cut(s)	17
BssMI	GATC	2 cut(s)	13, 184
BssT1I	CCWWGG	1 cut(s)	17
Bst2UI	CCWGG	1 cut(s)	199
Bst4CI	ACNGT	2 cut(s)	435, 465
BstBAI	YACGTR	1 cut(s)	277
BstDEI	CTNAG	1 cut(s)	426
BstEII	GGTNACC	1 cut(s)	592
BstF5I	GGATG	1 cut(s)	167
BstKTI	GATC	2 cut(s)	16, 187
BstMBI	GATC	2 cut(s)	13, 184
BstMWI	GCNNNNNNNGC	1 cut(s)	251
BstNI	CCWGG	1 cut(s)	199
BstPI	GGTNACC	1 cut(s)	592
BstSCI	CCNGG	1 cut(s)	197
BstX2I	RGATCY	2 cut(s)	13, 184
BstYI	RGATCY	2 cut(s)	13, 184
BsuRI	GGCC	3 cut(s)	5, 44, 202
BtsCI	GGATG	1 cut(s)	167
BtsIMutI	CAGTG	1 cut(s)	6
CaiI	CAGNNNCTG	1 cut(s)	77
Cfr13I	GGNCC	1 cut(s)	42
Csp6I	GTAC	1 cut(s)	231
CviAII	CATG	1 cut(s)	589
CviQI	GTAC	1 cut(s)	231
DdeI	CTNAG	1 cut(s)	426
DpnI	GATC	2 cut(s)	15, 186
DpnII	GATC	2 cut(s)	13, 184
EaeI	YGGCCR	1 cut(s)	3
Eco130I	CCWWGG	1 cut(s)	17
Eco57I	CTGAAG	1 cut(s)	193
Eco91I	GGTNACC	1 cut(s)	592
EcoO109I	RGGNCCY	1 cut(s)	42
EcoO65I	GGTNACC	1 cut(s)	592
EcoRII	CCWGG	1 cut(s)	197
EcoT14I	CCWWGG	1 cut(s)	17
ErhI	CCWWGG	1 cut(s)	17
FaeI	CATG	1 cut(s)	592
FaiI	YATR	5 cut(s)	60, 62, 111, 194, 590
FatI	CATG	1 cut(s)	588
FauI	CCCGC	8 cut(s)	355, 388, 421, 454, 484, 514, 544, 573
FauNDI	CATATG	1 cut(s)	60
FokI	GGATG	1 cut(s)	154
GsaI	CCCAGC	1 cut(s)	290
GsuI	CTGGAG	2 cut(s)	30, 243
HaeIII	GGCC	3 cut(s)	5, 44, 202
Hin1II	CATG	1 cut(s)	592
HinfI	GANTC	1 cut(s)	74
HphI	GGTGA	1 cut(s)	257
Hpy188I	TCNGA	1 cut(s)	73
Hpy188III	TCNNGA	1 cut(s)	222
HpyCH4III	ACNGT	2 cut(s)	435, 465
HpyCH4IV	ACGT	1 cut(s)	276
HpyCH4V	TGCA	2 cut(s)	139, 167
HpyF10VI	GCNNNNNNNGC	1 cut(s)	251
HpyF3I	CTNAG	1 cut(s)	426
HpySE526I	ACGT	1 cut(s)	276
Hsp92II	CATG	1 cut(s)	592
Kzo9I	GATC	2 cut(s)	13, 184
LweI	GCATC	2 cut(s)	170, 176
MaeII	ACGT	1 cut(s)	276
MaeIII	GTNAC	3 cut(s)	280, 310, 592
MalI	GATC	2 cut(s)	15, 186
MboI	GATC	2 cut(s)	13, 184
MboII	GAAGA	1 cut(s)	96
MfeI	CAATTG	1 cut(s)	234
MflI	RGATCY	2 cut(s)	13, 184
MlsI	TGGCCA	1 cut(s)	5
MluCI	AATT	4 cut(s)	28, 119, 151, 234
MluNI	TGGCCA	1 cut(s)	5
MmeI	TCCRAC	1 cut(s)	220
MnlI	CCTC	6 cut(s)	15, 55, 93, 150, 175, 585
Mox20I	TGGCCA	1 cut(s)	5
MscI	TGGCCA	1 cut(s)	5
Msp20I	TGGCCA	1 cut(s)	5
MspA1I	CMGCKG	7 cut(s)	290, 350, 383, 416, 449, 479, 568
MspR9I	CCNGG	1 cut(s)	199
MunI	CAATTG	1 cut(s)	234
MvaI	CCWGG	1 cut(s)	199
MwoI	GCNNNNNNNGC	1 cut(s)	251
NdeI	CATATG	1 cut(s)	60
NdeII	GATC	2 cut(s)	13, 184
NlaIII	CATG	1 cut(s)	592
NlaIV	GGNNCC	4 cut(s)	43, 147, 186, 215
PfeI	GAWTC	1 cut(s)	74
PflFI	GACNNNGTC	1 cut(s)	132
PflMI	CCANNNNNTGG	2 cut(s)	366, 399
Ppu21I	YACGTR	1 cut(s)	277
Psp6I	CCWGG	1 cut(s)	197
PspEI	GGTNACC	1 cut(s)	592
PspFI	CCCAGC	1 cut(s)	286
PspGI	CCWGG	1 cut(s)	197
PspN4I	GGNNCC	4 cut(s)	43, 147, 186, 215
PspPI	GGNCC	1 cut(s)	42
PstNI	CAGNNNCTG	1 cut(s)	77
PsuI	RGATCY	2 cut(s)	13, 184
PsyI	GACNNNGTC	1 cut(s)	132
PvuII	CAGCTG	1 cut(s)	290
RsaI	GTAC	1 cut(s)	232
RsaNI	GTAC	1 cut(s)	231
Sau3AI	GATC	2 cut(s)	13, 184
Sau96I	GGNCC	1 cut(s)	42
ScrFI	CCNGG	1 cut(s)	199
SetI	ASST	5 cut(s)	229, 247, 279, 292, 339
SfaNI	GCATC	2 cut(s)	170, 176
SmlI	CTYRAG	1 cut(s)	179
SmoI	CTYRAG	1 cut(s)	179
Sse9I	AATT	4 cut(s)	28, 119, 151, 234
SsiI	CCGC	8 cut(s)	348, 381, 414, 447, 477, 507, 537, 566
StyD4I	CCNGG	1 cut(s)	197
StyI	CCWWGG	1 cut(s)	17
TaaI	ACNGT	2 cut(s)	435, 465
TaiI	ACGT	1 cut(s)	279
TasI	AATT	4 cut(s)	28, 119, 151, 234
TfiI	GAWTC	1 cut(s)	74
TscAI	CASTG	1 cut(s)	13
TspDTI	ATGAA	1 cut(s)	181
TspRI	CASTG	1 cut(s)	13
Tth111I	GACNNNGTC	1 cut(s)	132
Van91I	CCANNNNNTGG	2 cut(s)	366, 399
XapI	RAATTY	1 cut(s)	151
XcmI	CCANNNNNNNNNTGG	1 cut(s)	586

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.