Rmu_co7983124.1_g000001

domain-containing protein

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co7983124.1
Physical Location & Seq
Reverse (-)
87 .. 374
288 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co7983124.1_g000001.1.cds

Sequence Viewer

Length: 288 bp
atggaagtcgttgatggaggaagcaatgagcttgatccaaaggaagggcaagatggaaatatcaaagaagaagcaaagcctgaggaaccagaggtaacagaaacgccgcaagcggctgctgctactatagggaataacaagaaggaggcggctcctgcatacaatgatgtgattgaggagactgcgagtaagctgatggcccaagagaagaggaggaacaaggtcaaagctttggttggggcttttgagactgtcatagatcatgaatcaggatccaaattaaattaa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

95

Amino Acids

10.21

Weight (kDa)

4.63

Isoelectric Point (pI)

56.94

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 3 cut(s) 107, 113, 149
AclWI GGATC 3 cut(s) 29, 267, 280
AfiI CCNNNNNNNGG 1 cut(s) 44
AluBI AGCT 3 cut(s) 31, 193, 230
AluI AGCT 3 cut(s) 31, 193, 230
Alw26I GTCTC 2 cut(s) 173, 242
AlwI GGATC 3 cut(s) 29, 267, 280
AoxI GGCC 1 cut(s) 198
ApeKI GCWGC 2 cut(s) 116, 119
AspS9I GGNCC 1 cut(s) 199
AxyI CCTNAGG 1 cut(s) 81
BamHI GGATCC 1 cut(s) 272
BbvI GCAGC 2 cut(s) 103, 106
BccI CCATC 3 cut(s) 8, 47, 190
BcoDI GTCTC 2 cut(s) 173, 242
BfmI CTRYAG 1 cut(s) 126
BisI GCNGC 5 cut(s) 107, 114, 117, 120, 150
BlsI GCNGC 5 cut(s) 108, 115, 118, 121, 151
BmgT120I GGNCC 1 cut(s) 199
BmiI GGNNCC 3 cut(s) 87, 153, 274
Bsc4I CCNNNNNNNGG 1 cut(s) 44
Bse21I CCTNAGG 1 cut(s) 81
Bse3DI GCAATG 1 cut(s) 31
BseLI CCNNNNNNNGG 1 cut(s) 44
BseMI GCAATG 1 cut(s) 31
BseMII CTCAG 1 cut(s) 72
BseRI GAGGAG 2 cut(s) 191, 226
BseXI GCAGC 2 cut(s) 103, 106
BshFI GGCC 1 cut(s) 200
BslI CCNNNNNNNGG 1 cut(s) 44
BsmAI GTCTC 2 cut(s) 173, 242
BsnI GGCC 1 cut(s) 200
Bsp143I GATC 3 cut(s) 34, 259, 272
BspACI CCGC 3 cut(s) 107, 113, 149
BspANI GGCC 1 cut(s) 200
BspCNI CTCAG 1 cut(s) 73
BspHI TCATGA 1 cut(s) 262
BspLI GGNNCC 3 cut(s) 87, 153, 274
BspPI GGATC 3 cut(s) 29, 267, 280
BsrDI GCAATG 1 cut(s) 31
BssMI GATC 3 cut(s) 34, 259, 272
Bst4CI ACNGT 1 cut(s) 253
Bst6I CTCTTC 1 cut(s) 203
BstC8I GCNNGC 1 cut(s) 111
BstDEI CTNAG 1 cut(s) 81
BstKTI GATC 3 cut(s) 37, 262, 275
BstMAI GTCTC 2 cut(s) 173, 242
BstMBI GATC 3 cut(s) 34, 259, 272
BstMWI GCNNNNNNNGC 2 cut(s) 119, 155
BstSFI CTRYAG 1 cut(s) 126
BstV1I GCAGC 2 cut(s) 103, 106
BstX2I RGATCY 1 cut(s) 272
BstYI RGATCY 1 cut(s) 272
Bsu36I CCTNAGG 1 cut(s) 81
BsuRI GGCC 1 cut(s) 200
Cac8I GCNNGC 1 cut(s) 111
CciI TCATGA 1 cut(s) 262
Cfr13I GGNCC 1 cut(s) 199
CviAII CATG 1 cut(s) 263
CviJI RGCY 8 cut(s) 31, 79, 116, 152, 193, 200, 230, 242
CviKI_1 RGCY 8 cut(s) 31, 79, 116, 152, 193, 200, 230, 242
DdeI CTNAG 1 cut(s) 81
DpnI GATC 3 cut(s) 36, 261, 274
DpnII GATC 3 cut(s) 34, 259, 272
Eam1104I CTCTTC 1 cut(s) 203
EarI CTCTTC 1 cut(s) 203
Eco81I CCTNAGG 1 cut(s) 81
FaeI CATG 1 cut(s) 266
FaiI YATR 4 cut(s) 128, 160, 257, 264
FatI CATG 1 cut(s) 262
Fnu4HI GCNGC 5 cut(s) 107, 114, 117, 120, 150
Fsp4HI GCNGC 5 cut(s) 107, 114, 117, 120, 150
GluI GCNGC 5 cut(s) 107, 114, 117, 120, 150
HaeIII GGCC 1 cut(s) 200
Hin1II CATG 1 cut(s) 266
HindIII AAGCTT 1 cut(s) 228
HinfI GANTC 1 cut(s) 266
Hpy188III TCNNGA 2 cut(s) 263, 270
HpyAV CCTTC 2 cut(s) 38, 136
HpyCH4III ACNGT 1 cut(s) 253
HpyCH4V TGCA 1 cut(s) 158
HpyF10VI GCNNNNNNNGC 2 cut(s) 119, 155
HpyF3I CTNAG 1 cut(s) 81
Hsp92II CATG 1 cut(s) 266
Kzo9I GATC 3 cut(s) 34, 259, 272
LmnI GCTCC 1 cut(s) 157
LpnPI CCDG 4 cut(s) 93, 102, 168, 255
Lsp1109I GCAGC 2 cut(s) 103, 106
MaeIII GTNAC 1 cut(s) 94
MalI GATC 3 cut(s) 36, 261, 274
MboI GATC 3 cut(s) 34, 259, 272
MboII GAAGA 2 cut(s) 80, 220
MflI RGATCY 1 cut(s) 272
MluCI AATT 2 cut(s) 278, 283
MnlI CCTC 7 cut(s) 11, 76, 85, 139, 169, 204, 207
MseI TTAA 2 cut(s) 281, 286
MwoI GCNNNNNNNGC 2 cut(s) 119, 155
NdeII GATC 3 cut(s) 34, 259, 272
NlaIII CATG 1 cut(s) 266
NlaIV GGNNCC 3 cut(s) 87, 153, 274
PagI TCATGA 1 cut(s) 262
PfeI GAWTC 1 cut(s) 266
PkrI GCNGC 5 cut(s) 108, 115, 118, 121, 151
PspN4I GGNNCC 3 cut(s) 87, 153, 274
PspPI GGNCC 1 cut(s) 199
PsuI RGATCY 1 cut(s) 272
SaqAI TTAA 2 cut(s) 281, 286
SatI GCNGC 5 cut(s) 107, 114, 117, 120, 150
Sau3AI GATC 3 cut(s) 34, 259, 272
Sau96I GGNCC 1 cut(s) 199
SetI ASST 5 cut(s) 33, 96, 195, 225, 232
SfcI CTRYAG 1 cut(s) 126
Sse9I AATT 2 cut(s) 278, 283
SsiI CCGC 3 cut(s) 107, 113, 149
TaaI ACNGT 1 cut(s) 253
TasI AATT 2 cut(s) 278, 283
TauI GCSGC 3 cut(s) 109, 116, 152
TfiI GAWTC 1 cut(s) 266
Tru1I TTAA 2 cut(s) 281, 286
Tru9I TTAA 2 cut(s) 281, 286
TseI GCWGC 2 cut(s) 116, 119
TspDTI ATGAA 1 cut(s) 279
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.