Rmu_co7992520.1_g000001

Pentatricopeptide repeat-containing protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co7992520.1
OG0015712
Physical Location & Seq
Reverse (-)
2 .. 448
447 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co7992520.1_g000001.1.cds

Sequence Viewer

Length: 447 bp
atggttattcatggcctttcagtgaaatgtggtgttgattttgatgtatttgttagtgttgcgttgatagagctctacagtgattgccaagctgtggactttgccaagagagtttatgaaggaatggagaacccgagtttaaatgcttccaatgcatatatagggaggcttgtatcgatgggtaggattgaagatgcagagagagtttttgatggagtgaaagagaaggattcagtttcatacaatttgatgattaaaggttatgcgatgagggatcaagtcaatgaggcaaagaggttatttgagtgtatgaagcacagaactatagtttcttccaatacaatgatttctgtgtactccaggaatggtgagattgataaggctttacagctttttgaagaaacgaaaggggaaagagaccatgtgacatggagtgccatgatgtcg
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Cation_ATPase E1-E2_ATPase PPR PPR_2 PhoLip_ATPase_C

Protein Analysis

149

Amino Acids

16.87

Weight (kDa)

5.4

Isoelectric Point (pI)

30.2

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 94
AclWI GGATC 1 cut(s) 282
AfaI GTAC 1 cut(s) 356
AfiI CCNNNNNNNGG 1 cut(s) 94
AgsI TTSAA 2 cut(s) 191, 398
AjnI CCWGG 1 cut(s) 359
AluBI AGCT 3 cut(s) 73, 92, 391
AluI AGCT 3 cut(s) 73, 92, 391
Alw21I GWGCWC 1 cut(s) 75
Alw26I GTCTC 1 cut(s) 411
AlwI GGATC 1 cut(s) 282
Ama87I CYCGRG 1 cut(s) 133
AoxI GGCC 1 cut(s) 13
AsuHPI GGTGA 1 cut(s) 380
AvaI CYCGRG 1 cut(s) 133
BanII GRGCYC 1 cut(s) 75
Bbv12I GWGCWC 1 cut(s) 75
BccI CCATC 2 cut(s) 172, 206
BciT130I CCWGG 1 cut(s) 361
BcoDI GTCTC 1 cut(s) 411
BfmI CTRYAG 2 cut(s) 76, 324
Bme1390I CCNGG 1 cut(s) 361
BmeT110I CYCGRG 1 cut(s) 133
BmrFI CCNGG 1 cut(s) 361
BmsI GCATC 1 cut(s) 184
BpmI CTGGAG 1 cut(s) 343
Bsa29I ATCGAT 1 cut(s) 176
BsaI GGTCTC 1 cut(s) 411
Bsc4I CCNNNNNNNGG 1 cut(s) 94
BseBI CCWGG 1 cut(s) 361
BseCI ATCGAT 1 cut(s) 176
BseLI CCNNNNNNNGG 1 cut(s) 94
BshFI GGCC 1 cut(s) 15
BshVI ATCGAT 1 cut(s) 176
BsiHKAI GWGCWC 1 cut(s) 75
BsiHKCI CYCGRG 1 cut(s) 133
BslI CCNNNNNNNGG 1 cut(s) 94
BsmAI GTCTC 1 cut(s) 411
BsnI GGCC 1 cut(s) 15
Bso31I GGTCTC 1 cut(s) 411
BsoBI CYCGRG 1 cut(s) 133
Bsp1286I GDGCHC 1 cut(s) 75
Bsp143I GATC 1 cut(s) 274
BspANI GGCC 1 cut(s) 15
BspDI ATCGAT 1 cut(s) 176
BspPI GGATC 1 cut(s) 282
BspTNI GGTCTC 1 cut(s) 411
BssMI GATC 1 cut(s) 274
Bst2UI CCWGG 1 cut(s) 361
Bst4CI ACNGT 1 cut(s) 80
BstKTI GATC 1 cut(s) 277
BstMAI GTCTC 1 cut(s) 411
BstMBI GATC 1 cut(s) 274
BstMWI GCNNNNNNNGC 1 cut(s) 152
BstNI CCWGG 1 cut(s) 361
BstSCI CCNGG 1 cut(s) 359
BstSFI CTRYAG 2 cut(s) 76, 324
Bsu15I ATCGAT 1 cut(s) 176
BsuRI GGCC 1 cut(s) 15
BsuTUI ATCGAT 1 cut(s) 176
BtgZI GCGATG 1 cut(s) 281
BtsIMutI CAGTG 2 cut(s) 27, 85
ClaI ATCGAT 1 cut(s) 176
Csp6I GTAC 1 cut(s) 355
CviAII CATG 4 cut(s) 11, 422, 429, 439
CviJI RGCY 6 cut(s) 15, 73, 92, 169, 383, 391
CviKI_1 RGCY 6 cut(s) 15, 73, 92, 169, 383, 391
CviQI GTAC 1 cut(s) 355
DpnI GATC 1 cut(s) 276
DpnII GATC 1 cut(s) 274
DraI TTTAAA 1 cut(s) 141
Ecl136II GAGCTC 1 cut(s) 73
Eco24I GRGCYC 1 cut(s) 75
Eco31I GGTCTC 1 cut(s) 411
Eco53kI GAGCTC 1 cut(s) 73
Eco88I CYCGRG 1 cut(s) 133
EcoICRI GAGCTC 1 cut(s) 73
EcoRII CCWGG 1 cut(s) 359
EcoT22I ATGCAT 1 cut(s) 157
EcoT38I GRGCYC 1 cut(s) 75
FaeI CATG 4 cut(s) 14, 425, 432, 442
FatI CATG 4 cut(s) 10, 421, 428, 438
FriOI GRGCYC 1 cut(s) 75
GsuI CTGGAG 1 cut(s) 343
HaeIII GGCC 1 cut(s) 15
Hin1II CATG 4 cut(s) 14, 425, 432, 442
HinfI GANTC 1 cut(s) 230
HphI GGTGA 1 cut(s) 380
Hpy166II GTNNAC 2 cut(s) 97, 355
Hpy8I GTNNAC 2 cut(s) 97, 355
HpyAV CCTTC 2 cut(s) 113, 220
HpyCH4III ACNGT 1 cut(s) 80
HpyCH4V TGCA 2 cut(s) 155, 197
HpyF10VI GCNNNNNNNGC 1 cut(s) 152
Hsp92II CATG 4 cut(s) 14, 425, 432, 442
Kzo9I GATC 1 cut(s) 274
LpnPI CCDG 2 cut(s) 346, 373
LweI GCATC 1 cut(s) 184
MaeIII GTNAC 1 cut(s) 424
MalI GATC 1 cut(s) 276
MboI GATC 1 cut(s) 274
MboII GAAGA 3 cut(s) 203, 324, 410
MhlI GDGCHC 1 cut(s) 75
MluCI AATT 1 cut(s) 244
MnlI CCTC 4 cut(s) 159, 264, 280, 288
Mph1103I ATGCAT 1 cut(s) 157
MseI TTAA 2 cut(s) 140, 255
MspR9I CCNGG 1 cut(s) 361
MvaI CCWGG 1 cut(s) 361
MwoI GCNNNNNNNGC 1 cut(s) 152
NdeII GATC 1 cut(s) 274
NlaIII CATG 4 cut(s) 14, 425, 432, 442
NmuCI GTSAC 1 cut(s) 424
NsiI ATGCAT 1 cut(s) 157
PfeI GAWTC 1 cut(s) 230
PflMI CCANNNNNTGG 1 cut(s) 94
PfoI TCCNGGA 1 cut(s) 359
Psp124BI GAGCTC 1 cut(s) 75
Psp6I CCWGG 1 cut(s) 359
PspGI CCWGG 1 cut(s) 359
RsaI GTAC 1 cut(s) 356
RsaNI GTAC 1 cut(s) 355
SacI GAGCTC 1 cut(s) 75
SaqAI TTAA 2 cut(s) 140, 255
Sau3AI GATC 1 cut(s) 274
ScrFI CCNGG 1 cut(s) 361
SduI GDGCHC 1 cut(s) 75
SetI ASST 5 cut(s) 75, 94, 262, 299, 393
SfaNI GCATC 1 cut(s) 184
SfcI CTRYAG 2 cut(s) 76, 324
Sse9I AATT 1 cut(s) 244
SstI GAGCTC 1 cut(s) 75
StyD4I CCNGG 1 cut(s) 359
TaaI ACNGT 1 cut(s) 80
TaqI TCGA 1 cut(s) 176
TasI AATT 1 cut(s) 244
TatI WGTACW 1 cut(s) 354
TfiI GAWTC 1 cut(s) 230
Tru1I TTAA 2 cut(s) 140, 255
Tru9I TTAA 2 cut(s) 140, 255
TscAI CASTG 2 cut(s) 27, 85
TseFI GTSAC 1 cut(s) 424
Tsp45I GTSAC 1 cut(s) 424
TspDTI ATGAA 3 cut(s) 132, 228, 326
TspRI CASTG 2 cut(s) 27, 85
Van91I CCANNNNNTGG 1 cut(s) 94
Zsp2I ATGCAT 1 cut(s) 157
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.