Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0001232.1

Orthogroup ID

OG0015712

Physical Location & Seq

Genomic Coordinates Reverse (-)

69788 .. 71221

Gene Structure 1434 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0001232.1_g000019.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 1434 bp

atggttattcatggcctttcagtgaaatgtggtgttgattttgatgtatttgttagtgttgcgttgatagagctctacagtgattgccaagctgtggactttgccaagagagtttatgaaggaatggagaacccgagtttaaatgcttccaatgcatatatagggaggcttgtatcgatgggtaggattgaagatgcagagagagtttttgatggagtgaaagagaaggattcagtttcatacaatttgatgattaaaggttatgcgatgagggatcaagtcaatgaggcaaagaggttatttgagtgtatgaagcacagaactatagtttcttccaatacaatgatttctgtgtactccaggaatggtgagattgataaggctttacagctttttgaagaaacgaaaggggaaagagaccatgtgacatggagtgccatgatgtcgggttatattcataatcagcaacatgaggaggctctggaactatatggtacaatgtgcagattatcaatagaccgtacaagatcaacattcgctgctctatttcatgcctgttcatgccttggttctcttgagttgggacaagtgctccatgcccagttgatcaagacaccatttgaatcgaatgtatatgttggaacttctctaattgatatgtattcgaaatgtgggtgcatcactgatgcagaaacatcctttaacagcattacttcacccaatgtggcagcttggacagctctcattaatgggtgtgcacaacatgggcttggctctgaggcagttttgttgtttgagagaatgttaaagcaaggattcatccctaatgctgctactgtttttggggttctgtctgcctgcaatcattctggcctagtcaatgaagggaggagaatatatgacttaatggaaaaaagttatgggataaacccaagtttggaacactgtgcatgcatagtagatcttcttggtcggtctggccgtctacaagaagctatggattttattgaagaaatgaccgttgaaccagatggagttatctggggagcaatgctcaatgcgtgttggttgtggatggacacagaactcgctgagcaggtagctgagaaaatgtgtagtttggatcccaagccagtatctgcttatgtaattttatccaacatatatgctgtacaggggaagtttgaggagaagatcaacgctagaaacagattgagaaaattgaaagcaaaaaaggatcctggatgcagttggattcggctgaatttccaagttcatcaattctctgtacaagatactaaccatcctcattgtaccatgatttacaaaactttggagcatctgacagcaaatatgaactctattgttgaatttggttctgtttatatgccaacagtaaactctagttctatctatgcaacatatattctatga

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

Cation_ATPase E1-E2_ATPase PPR PPR_2 PhoLip_ATPase_C

Protein Analysis

477

Amino Acids

53.38

Weight (kDa)

5.65

Isoelectric Point (pI)

37.01

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0015712)

Species	Orthologous Gene IDs
malus_domestica	MD01G1215800.v1.1
prunus_persica	Prupe.2G307900_v2.0.a1
pyrus_communis	pycom01g22660
rosa_chinensis	RchiOBHm_Chr1g0380161
rosa_laevigata	RLG00000026325
rosa_multiflora	Rmu_co7992520.1_g000001 Rmu_sc0001232.1_g000019 Rmu_sc0016989.1_g000006 Rmu_sc0041528.1_g000001 Rmu_sc0041619.1_g000001
rosa_roxburghii	Rroxscaffold_4G00279620
rosa_rugosa	Rorug01G0418400
rosa_samantha	Rh1AG443300 Rh1BG398200 Rh1CG411600
rosa_wichuraiana	Rw1G038490

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
Acc36I	ACCTGC	1 cut(s)	1087
AccB7I	CCANNNNNTGG	1 cut(s)	94
AccI	GTMKAC	1 cut(s)	985
AclWI	GGATC	5 cut(s)	282, 1118, 1131, 1232, 1245
AcoI	YGGCCR	1 cut(s)	979
AcsI	RAATTY	2 cut(s)	1264, 1370
AfaI	GTAC	6 cut(s)	356, 496, 523, 1173, 1290, 1315
AfiI	CCNNNNNNNGG	2 cut(s)	94, 937
AgsI	TTSAA	7 cut(s)	191, 398, 623, 1010, 1025, 1225, 1370
AjnI	CCWGG	2 cut(s)	359, 1240
AluBI	AGCT	7 cut(s)	73, 92, 391, 731, 740, 995, 1103
AluI	AGCT	7 cut(s)	73, 92, 391, 731, 740, 995, 1103
Alw21I	GWGCWC	3 cut(s)	75, 594, 760
Alw26I	GTCTC	1 cut(s)	411
Alw44I	GTGCAC	1 cut(s)	756
AlwI	GGATC	5 cut(s)	282, 1118, 1131, 1232, 1245
AlwNI	CAGNNNCTG	1 cut(s)	1139
Ama87I	CYCGRG	1 cut(s)	133
AoxI	GGCC	3 cut(s)	13, 871, 979
ApaLI	GTGCAC	1 cut(s)	756
ApeKI	GCWGC	3 cut(s)	539, 728, 830
ApoI	RAATTY	2 cut(s)	1264, 1370
AseI	ATTAAT	1 cut(s)	747
AsuHPI	GGTGA	2 cut(s)	380, 708
AsuII	TTCGAA	1 cut(s)	665
AvaI	CYCGRG	1 cut(s)	133
BaeGI	GKGCMC	1 cut(s)	760
BamHI	GGATCC	2 cut(s)	1123, 1237
BanII	GRGCYC	1 cut(s)	75
Bbv12I	GWGCWC	3 cut(s)	75, 594, 760
BbvI	GCAGC	3 cut(s)	526, 740, 817
BccI	CCATC	5 cut(s)	172, 206, 1025, 1069, 1311
BceAI	ACGGC	1 cut(s)	966
BciT130I	CCWGG	2 cut(s)	361, 1242
BclI	TGATCA	1 cut(s)	606
BcoDI	GTCTC	1 cut(s)	411
BfaI	CTAG	3 cut(s)	875, 1203, 1404
BfmI	CTRYAG	2 cut(s)	76, 324
BfuAI	ACCTGC	1 cut(s)	1087
BglII	AGATCT	1 cut(s)	961
BisI	GCNGC	3 cut(s)	540, 729, 831
BlpI	GCTNAGC	1 cut(s)	1092
BlsI	GCNGC	3 cut(s)	541, 730, 832
Bme1390I	CCNGG	2 cut(s)	361, 1242
BmeT110I	CYCGRG	1 cut(s)	133
BmiI	GGNNCC	2 cut(s)	1125, 1239
BmrFI	CCNGG	2 cut(s)	361, 1242
BmrI	ACTGGG	1 cut(s)	595
BmsI	GCATC	5 cut(s)	184, 676, 687, 1235, 1348
BmuI	ACTGGG	1 cut(s)	595
BplI	GAGNNNNNCTC	2 cut(s)	1038, 1070
BpmI	CTGGAG	1 cut(s)	343
Bpu1102I	GCTNAGC	1 cut(s)	1092
Bpu14I	TTCGAA	1 cut(s)	665
BpuEI	CTTGAG	1 cut(s)	596
Bsa29I	ATCGAT	1 cut(s)	176
BsaI	GGTCTC	1 cut(s)	411
BsaJI	CCNNGG	1 cut(s)	565
BsaXI	ACNNNNNCTCC	2 cut(s)	576, 606
Bsc4I	CCNNNNNNNGG	2 cut(s)	94, 937
Bse1I	ACTGG	2 cut(s)	601, 1133
Bse3DI	GCAATG	1 cut(s)	1056
BseBI	CCWGG	2 cut(s)	361, 1242
BseCI	ATCGAT	1 cut(s)	176
BseDI	CCNNGG	1 cut(s)	565
BseGI	GGATG	5 cut(s)	695, 819, 1080, 1250, 1303
BseLI	CCNNNNNNNGG	2 cut(s)	94, 937
BseMI	GCAATG	1 cut(s)	1056
BseMII	CTCAG	3 cut(s)	768, 1083, 1095
BseNI	ACTGG	2 cut(s)	601, 1133
BseRI	GAGGAG	3 cut(s)	488, 904, 1202
BseSI	GKGCMC	1 cut(s)	760
BseXI	GCAGC	3 cut(s)	526, 740, 817
BsgI	GTGCAG	1 cut(s)	523
BshFI	GGCC	3 cut(s)	15, 873, 981
BshVI	ATCGAT	1 cut(s)	176
BsiHKAI	GWGCWC	3 cut(s)	75, 594, 760
BsiHKCI	CYCGRG	1 cut(s)	133
BslFI	GGGAC	1 cut(s)	597
BslI	CCNNNNNNNGG	2 cut(s)	94, 937
BsmAI	GTCTC	1 cut(s)	411
BsmFI	GGGAC	1 cut(s)	597
BsnI	GGCC	3 cut(s)	15, 873, 981
Bso31I	GGTCTC	1 cut(s)	411
BsoBI	CYCGRG	1 cut(s)	133
Bsp119I	TTCGAA	1 cut(s)	665
Bsp1286I	GDGCHC	3 cut(s)	75, 594, 760
Bsp1407I	TGTACA	2 cut(s)	1171, 1288
Bsp143I	GATC	7 cut(s)	274, 527, 606, 961, 1123, 1194, 1237
Bsp1720I	GCTNAGC	1 cut(s)	1092
BspANI	GGCC	3 cut(s)	15, 873, 981
BspCNI	CTCAG	3 cut(s)	769, 1084, 1096
BspDI	ATCGAT	1 cut(s)	176
BspLI	GGNNCC	2 cut(s)	1125, 1239
BspMI	ACCTGC	1 cut(s)	1087
BspPI	GGATC	5 cut(s)	282, 1118, 1131, 1232, 1245
BspT104I	TTCGAA	1 cut(s)	665
BspTNI	GGTCTC	1 cut(s)	411
BsrDI	GCAATG	1 cut(s)	1056
BsrGI	TGTACA	2 cut(s)	1171, 1288
BsrI	ACTGG	2 cut(s)	601, 1133
BssECI	CCNNGG	1 cut(s)	565
BssMI	GATC	7 cut(s)	274, 527, 606, 961, 1123, 1194, 1237
BssT1I	CCWWGG	1 cut(s)	565
Bst2UI	CCWGG	2 cut(s)	361, 1242
Bst4CI	ACNGT	6 cut(s)	80, 521, 838, 947, 1021, 1396
BstAUI	TGTACA	2 cut(s)	1171, 1288
BstBI	TTCGAA	1 cut(s)	665
BstC8I	GCNNGC	2 cut(s)	859, 952
BstDEI	CTNAG	3 cut(s)	777, 1092, 1104
BstF5I	GGATG	5 cut(s)	695, 819, 1080, 1250, 1303
BstKTI	GATC	7 cut(s)	277, 530, 609, 964, 1126, 1197, 1240
BstMAI	GTCTC	1 cut(s)	411
BstMBI	GATC	7 cut(s)	274, 527, 606, 961, 1123, 1194, 1237
BstMWI	GCNNNNNNNGC	2 cut(s)	152, 737
BstNI	CCWGG	2 cut(s)	361, 1242
BstNSI	RCATGY	1 cut(s)	954
BstSCI	CCNGG	2 cut(s)	359, 1240
BstSFI	CTRYAG	2 cut(s)	76, 324
BstSLI	GKGCMC	1 cut(s)	760
BstV1I	GCAGC	3 cut(s)	526, 740, 817
BstX2I	RGATCY	3 cut(s)	961, 1123, 1237
BstYI	RGATCY	3 cut(s)	961, 1123, 1237
Bsu15I	ATCGAT	1 cut(s)	176
BsuRI	GGCC	3 cut(s)	15, 873, 981
BsuTUI	ATCGAT	1 cut(s)	176
BtgZI	GCGATG	1 cut(s)	281
BtsCI	GGATG	5 cut(s)	695, 819, 1080, 1250, 1303
BtsIMutI	CAGTG	4 cut(s)	27, 85, 681, 943
BveI	ACCTGC	1 cut(s)	1087
Cac8I	GCNNGC	2 cut(s)	859, 952
CaiI	CAGNNNCTG	1 cut(s)	1139
ClaI	ATCGAT	1 cut(s)	176
Csp6I	GTAC	6 cut(s)	355, 495, 522, 1172, 1289, 1314
CviQI	GTAC	6 cut(s)	355, 495, 522, 1172, 1289, 1314
DdeI	CTNAG	3 cut(s)	777, 1092, 1104
DpnI	GATC	7 cut(s)	276, 529, 608, 963, 1125, 1196, 1239
DpnII	GATC	7 cut(s)	274, 527, 606, 961, 1123, 1194, 1237
DraI	TTTAAA	1 cut(s)	141
EaeI	YGGCCR	1 cut(s)	979
Ecl136II	GAGCTC	1 cut(s)	73
Eco130I	CCWWGG	1 cut(s)	565
Eco24I	GRGCYC	1 cut(s)	75
Eco31I	GGTCTC	1 cut(s)	411
Eco53kI	GAGCTC	1 cut(s)	73
Eco88I	CYCGRG	1 cut(s)	133
EcoICRI	GAGCTC	1 cut(s)	73
EcoRII	CCWGG	2 cut(s)	359, 1240
EcoT14I	CCWWGG	1 cut(s)	565
EcoT22I	ATGCAT	2 cut(s)	157, 956
EcoT38I	GRGCYC	1 cut(s)	75
ErhI	CCWWGG	1 cut(s)	565
FaqI	GGGAC	1 cut(s)	597
FbaI	TGATCA	1 cut(s)	606
FblI	GTMKAC	1 cut(s)	985
Fnu4HI	GCNGC	3 cut(s)	540, 729, 831
FokI	GGATG	5 cut(s)	682, 806, 1087, 1257, 1290
FriOI	GRGCYC	1 cut(s)	75
Fsp4HI	GCNGC	3 cut(s)	540, 729, 831
FspBI	CTAG	3 cut(s)	875, 1203, 1404
GluI	GCNGC	3 cut(s)	540, 729, 831
GsuI	CTGGAG	1 cut(s)	343
HaeIII	GGCC	3 cut(s)	15, 873, 981
HinfI	GANTC	4 cut(s)	230, 623, 816, 1255
HphI	GGTGA	2 cut(s)	380, 708
Hpy166II	GTNNAC	5 cut(s)	97, 355, 758, 986, 1399
Hpy188I	TCNGA	2 cut(s)	778, 1344
Hpy188III	TCNNGA	3 cut(s)	482, 575, 610
Hpy8I	GTNNAC	5 cut(s)	97, 355, 758, 986, 1399
HpyAV	CCTTC	3 cut(s)	113, 220, 878
HpyCH4III	ACNGT	6 cut(s)	80, 521, 838, 947, 1021, 1396
HpyF10VI	GCNNNNNNNGC	2 cut(s)	152, 737
HpyF3I	CTNAG	3 cut(s)	777, 1092, 1104
Ksp22I	TGATCA	1 cut(s)	606
Kzo9I	GATC	7 cut(s)	274, 527, 606, 961, 1123, 1194, 1237
LmnI	GCTCC	3 cut(s)	597, 1046, 1336
Lsp1109I	GCAGC	3 cut(s)	526, 740, 817
LweI	GCATC	5 cut(s)	184, 676, 687, 1235, 1348
MaeI	CTAG	3 cut(s)	875, 1203, 1404
MaeIII	GTNAC	1 cut(s)	424
MalI	GATC	7 cut(s)	276, 529, 608, 963, 1125, 1196, 1239
MboI	GATC	7 cut(s)	274, 527, 606, 961, 1123, 1194, 1237
MboII	GAAGA	6 cut(s)	203, 324, 410, 956, 1022, 1204
MflI	RGATCY	3 cut(s)	961, 1123, 1237
MhlI	GDGCHC	3 cut(s)	75, 594, 760
MluCI	AATT	7 cut(s)	244, 651, 1149, 1220, 1264, 1280, 1370
MmeI	TCCRAC	3 cut(s)	619, 1182, 1232
Mph1103I	ATGCAT	2 cut(s)	157, 956
MseI	TTAA	6 cut(s)	140, 255, 702, 747, 806, 905
MspR9I	CCNGG	2 cut(s)	361, 1242
MvaI	CCWGG	2 cut(s)	361, 1242
MwoI	GCNNNNNNNGC	2 cut(s)	152, 737
NdeII	GATC	7 cut(s)	274, 527, 606, 961, 1123, 1194, 1237
NlaIV	GGNNCC	2 cut(s)	1125, 1239
NmuCI	GTSAC	1 cut(s)	424
NsiI	ATGCAT	2 cut(s)	157, 956
NspI	RCATGY	1 cut(s)	954
NspV	TTCGAA	1 cut(s)	665
PaeI	GCATGC	1 cut(s)	954
PcsI	WCGNNNNNNNCGW	1 cut(s)	979
PfeI	GAWTC	4 cut(s)	230, 623, 816, 1255
PflMI	CCANNNNNTGG	1 cut(s)	94
PfoI	TCCNGGA	2 cut(s)	359, 1240
PkrI	GCNGC	3 cut(s)	541, 730, 832
PshBI	ATTAAT	1 cut(s)	747
Psp124BI	GAGCTC	1 cut(s)	75
Psp6I	CCWGG	2 cut(s)	359, 1240
PspGI	CCWGG	2 cut(s)	359, 1240
PspN4I	GGNNCC	2 cut(s)	1125, 1239
PstNI	CAGNNNCTG	1 cut(s)	1139
PsuI	RGATCY	3 cut(s)	961, 1123, 1237
RsaI	GTAC	6 cut(s)	356, 496, 523, 1173, 1290, 1315
RsaNI	GTAC	6 cut(s)	355, 495, 522, 1172, 1289, 1314
SacI	GAGCTC	1 cut(s)	75
SaqAI	TTAA	6 cut(s)	140, 255, 702, 747, 806, 905
SatI	GCNGC	3 cut(s)	540, 729, 831
Sau3AI	GATC	7 cut(s)	274, 527, 606, 961, 1123, 1194, 1237
ScrFI	CCNGG	2 cut(s)	361, 1242
SduI	GDGCHC	3 cut(s)	75, 594, 760
SfaNI	GCATC	5 cut(s)	184, 676, 687, 1235, 1348
SfcI	CTRYAG	2 cut(s)	76, 324
SfuI	TTCGAA	1 cut(s)	665
SmlI	CTYRAG	1 cut(s)	575
SmoI	CTYRAG	1 cut(s)	575
SphI	GCATGC	1 cut(s)	954
Sse9I	AATT	7 cut(s)	244, 651, 1149, 1220, 1264, 1280, 1370
SspMI	CTAG	3 cut(s)	875, 1203, 1404
SstI	GAGCTC	1 cut(s)	75
StyD4I	CCNGG	2 cut(s)	359, 1240
StyI	CCWWGG	1 cut(s)	565
TaaI	ACNGT	6 cut(s)	80, 521, 838, 947, 1021, 1396
TaqI	TCGA	3 cut(s)	176, 626, 665
TaqII	GACCGA	1 cut(s)	963
TasI	AATT	7 cut(s)	244, 651, 1149, 1220, 1264, 1280, 1370
TatI	WGTACW	3 cut(s)	354, 1171, 1288
TfiI	GAWTC	4 cut(s)	230, 623, 816, 1255
Tru1I	TTAA	6 cut(s)	140, 255, 702, 747, 806, 905
Tru9I	TTAA	6 cut(s)	140, 255, 702, 747, 806, 905
TscAI	CASTG	4 cut(s)	27, 85, 688, 950
TseFI	GTSAC	1 cut(s)	424
TseI	GCWGC	3 cut(s)	539, 728, 830
Tsp45I	GTSAC	1 cut(s)	424
TspRI	CASTG	4 cut(s)	27, 85, 688, 950
Van91I	CCANNNNNTGG	1 cut(s)	94
VneI	GTGCAC	1 cut(s)	756
VspI	ATTAAT	1 cut(s)	747
XapI	RAATTY	2 cut(s)	1264, 1370
XceI	RCATGY	1 cut(s)	954
XmiI	GTMKAC	1 cut(s)	985
XspI	CTAG	3 cut(s)	875, 1203, 1404
Zsp2I	ATGCAT	2 cut(s)	157, 956

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.