Rmu_co7999548.1_g000001

Belongs to the plant LTP family

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co7999548.1
Physical Location & Seq
Forward (+)
107 .. 525
419 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co7999548.1_g000001.1.cds

Sequence Viewer

Length: 331 bp
atggctccaacaccggactgttgcagtggtctgaaacaagtcctgaacaaaaataaaacgtgcctctgcgttatcattcaagatcgcaacgaccctgatttgggcctaaagatcaatgtcactcttgctttgggcctgccttccgtctgccacgtcgccgccaatatctccaagtgtcccgaacttctacacttggatcccaaatcaccagaagctcaagtgttctatcagttacagaacaactctacgcaaaccgccgccaatggtcctgctccgggtccaagtagtatgtacaataaatatatcattgagattgcagataatttggggc
Functional Annotation
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

110

Amino Acids

11.78

Weight (kDa)

6.02

Isoelectric Point (pI)

56.18

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 3 cut(s) 159, 255, 258
AclWI GGATC 2 cut(s) 191, 204
AfaI GTAC 1 cut(s) 293
AfiI CCNNNNNNNGG 3 cut(s) 100, 101, 275
AgsI TTSAA 1 cut(s) 80
AjiI CACGTC 1 cut(s) 154
AluBI AGCT 1 cut(s) 215
AluI AGCT 1 cut(s) 215
AlwI GGATC 2 cut(s) 191, 204
AoxI GGCC 2 cut(s) 103, 133
AspS9I GGNCC 4 cut(s) 103, 133, 266, 278
AsuC2I CCSGG 1 cut(s) 276
AsuHPI GGTGA 1 cut(s) 198
AvaII GGWCC 2 cut(s) 266, 278
BamHI GGATCC 1 cut(s) 196
BcnI CCSGG 1 cut(s) 276
BisI GCNGC 2 cut(s) 159, 258
BlsI GCNGC 2 cut(s) 160, 259
Bme1390I CCNGG 1 cut(s) 276
Bme18I GGWCC 2 cut(s) 266, 278
BmgBI CACGTC 1 cut(s) 154
BmgT120I GGNCC 4 cut(s) 103, 133, 266, 278
BmiI GGNNCC 3 cut(s) 6, 198, 279
BmrFI CCNGG 1 cut(s) 276
BpuEI CTTGAG 1 cut(s) 201
BpuMI CCSGG 1 cut(s) 276
BsaWI WCCGGW 1 cut(s) 13
Bsc4I CCNNNNNNNGG 3 cut(s) 100, 101, 275
BseLI CCNNNNNNNGG 3 cut(s) 100, 101, 275
BshFI GGCC 2 cut(s) 105, 135
BsiSI CCGG 2 cut(s) 14, 275
BslFI GGGAC 1 cut(s) 162
BslI CCNNNNNNNGG 3 cut(s) 100, 101, 275
BsmFI GGGAC 1 cut(s) 162
BsnI GGCC 2 cut(s) 105, 135
Bsp1407I TGTACA 1 cut(s) 291
Bsp143I GATC 3 cut(s) 82, 111, 196
BspACI CCGC 3 cut(s) 159, 255, 258
BspANI GGCC 2 cut(s) 105, 135
BspLI GGNNCC 3 cut(s) 6, 198, 279
BspPI GGATC 2 cut(s) 191, 204
BsrGI TGTACA 1 cut(s) 291
BssMI GATC 3 cut(s) 82, 111, 196
Bst4CI ACNGT 1 cut(s) 20
BstAUI TGTACA 1 cut(s) 291
BstC8I GCNNGC 1 cut(s) 137
BstKTI GATC 3 cut(s) 85, 114, 199
BstMBI GATC 3 cut(s) 82, 111, 196
BstSCI CCNGG 1 cut(s) 274
BstX2I RGATCY 1 cut(s) 196
BstYI RGATCY 1 cut(s) 196
BsuRI GGCC 2 cut(s) 105, 135
BtrI CACGTC 1 cut(s) 154
BtsI GCAGTG 1 cut(s) 31
BtsIMutI CAGTG 1 cut(s) 31
Cac8I GCNNGC 1 cut(s) 137
Cfr13I GGNCC 4 cut(s) 103, 133, 266, 278
Csp6I GTAC 1 cut(s) 292
CviJI RGCY 4 cut(s) 5, 105, 135, 215
CviKI_1 RGCY 4 cut(s) 5, 105, 135, 215
CviQI GTAC 1 cut(s) 292
DpnI GATC 3 cut(s) 84, 113, 198
DpnII GATC 3 cut(s) 82, 111, 196
Eco47I GGWCC 2 cut(s) 266, 278
FaiI YATR 2 cut(s) 290, 303
FaqI GGGAC 1 cut(s) 162
Fnu4HI GCNGC 2 cut(s) 159, 258
Fsp4HI GCNGC 2 cut(s) 159, 258
GluI GCNGC 2 cut(s) 159, 258
HaeIII GGCC 2 cut(s) 105, 135
HapII CCGG 2 cut(s) 14, 275
HpaII CCGG 2 cut(s) 14, 275
HphI GGTGA 1 cut(s) 198
Hpy188I TCNGA 1 cut(s) 33
Hpy188III TCNNGA 3 cut(s) 43, 80, 179
Hpy99I CGWCG 1 cut(s) 158
HpyAV CCTTC 1 cut(s) 150
HpyCH4III ACNGT 1 cut(s) 20
HpyCH4IV ACGT 2 cut(s) 59, 153
HpyCH4V TGCA 2 cut(s) 24, 317
HpySE526I ACGT 2 cut(s) 59, 153
Kzo9I GATC 3 cut(s) 82, 111, 196
LmnI GCTCC 2 cut(s) 10, 277
LpnPI CCDG 7 cut(s) 27, 56, 108, 149, 222, 282, 288
MaeII ACGT 2 cut(s) 59, 153
MaeIII GTNAC 2 cut(s) 118, 231
MalI GATC 3 cut(s) 84, 113, 198
MboI GATC 3 cut(s) 82, 111, 196
MflI RGATCY 1 cut(s) 196
MluCI AATT 1 cut(s) 322
MmeI TCCRAC 1 cut(s) 32
MnlI CCTC 1 cut(s) 74
MspI CCGG 2 cut(s) 14, 275
MspR9I CCNGG 1 cut(s) 276
NciI CCSGG 1 cut(s) 276
NdeII GATC 3 cut(s) 82, 111, 196
NlaIV GGNNCC 3 cut(s) 6, 198, 279
NmuCI GTSAC 1 cut(s) 118
PkrI GCNGC 2 cut(s) 160, 259
PspN4I GGNNCC 3 cut(s) 6, 198, 279
PspPI GGNCC 4 cut(s) 103, 133, 266, 278
PsuI RGATCY 1 cut(s) 196
RsaI GTAC 1 cut(s) 293
RsaNI GTAC 1 cut(s) 292
SatI GCNGC 2 cut(s) 159, 258
Sau3AI GATC 3 cut(s) 82, 111, 196
Sau96I GGNCC 4 cut(s) 103, 133, 266, 278
ScrFI CCNGG 1 cut(s) 276
SetI ASST 3 cut(s) 62, 156, 217
SinI GGWCC 2 cut(s) 266, 278
SmlI CTYRAG 1 cut(s) 216
SmoI CTYRAG 1 cut(s) 216
Sse9I AATT 1 cut(s) 322
SsiI CCGC 3 cut(s) 159, 255, 258
StyD4I CCNGG 1 cut(s) 274
TaaI ACNGT 1 cut(s) 20
TaiI ACGT 2 cut(s) 62, 156
TasI AATT 1 cut(s) 322
TatI WGTACW 1 cut(s) 291
TauI GCSGC 2 cut(s) 161, 260
TscAI CASTG 1 cut(s) 31
TseFI GTSAC 1 cut(s) 118
Tsp45I GTSAC 1 cut(s) 118
TspGWI ACGGA 1 cut(s) 133
TspRI CASTG 1 cut(s) 31
VpaK11BI GGWCC 2 cut(s) 266, 278
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.