Rmu_co8035226.1_g000001

Pentatricopeptide repeat-containing protein

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co8035226.1
Physical Location & Seq
Forward (+)
1 .. 549
549 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co8035226.1_g000001.1.cds

Sequence Viewer

Length: 549 bp
cccttttgttttgaaggcgtgtgcgaggcgtttggacttgcaattggggttgaagattcatacgcttgtggtgaagacgggttttgactttgatgtttatgtgaaaactagtctgctttttatgtatgcgaagtgtgggtatatggaacatgcgcgtaaggtattcgatgatttgcctgagaagaatgttgtttcttggactgccgtagtttccgggtatattggagctgggaagtatagggaagctattgatacatttctgaggttgttggagatgggtttgaggcctgatagtctaagccttgttcgggctttatcggcgtgtagtcagttaggggatttacgcagtggggagtggatagataattacattacggagattgggatggcgaggaatgtgtttgtggctacctctttggttgatttgtatgccaagtgtggtaacatggagaaagcgcgtcttgtgtttgatggaatagctgagaaggatatagttgcttggagtagcatgattcagggatatgcatcgaatgggcttcctaaagaagc
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

183

Amino Acids

20.37

Weight (kDa)

8.08

Isoelectric Point (pI)

34.76

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0014523)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccII CGCG 2 cut(s) 155, 458
AfiI CCNNNNNNNGG 1 cut(s) 308
AgsI TTSAA 2 cut(s) 14, 53
AhlI ACTAGT 1 cut(s) 108
AluBI AGCT 3 cut(s) 228, 246, 480
AluI AGCT 3 cut(s) 228, 246, 480
AoxI GGCC 1 cut(s) 285
AspLEI GCGC 2 cut(s) 155, 458
AsuC2I CCSGG 1 cut(s) 215
AsuHPI GGTGA 1 cut(s) 83
BbsI GAAGAC 1 cut(s) 81
BccI CCATC 3 cut(s) 269, 380, 465
BceAI ACGGC 1 cut(s) 189
BcnI CCSGG 1 cut(s) 215
BcuI ACTAGT 1 cut(s) 108
BfaI CTAG 1 cut(s) 109
Bme1390I CCNGG 1 cut(s) 215
BmrFI CCNGG 1 cut(s) 215
BmsI GCATC 1 cut(s) 534
BpiI GAAGAC 1 cut(s) 81
BpuMI CCSGG 1 cut(s) 215
BsaBI GATNNNNATC 1 cut(s) 524
Bsc4I CCNNNNNNNGG 1 cut(s) 308
Bse8I GATNNNNATC 1 cut(s) 524
BseGI GGATG 1 cut(s) 391
BseJI GATNNNNATC 1 cut(s) 524
BseLI CCNNNNNNNGG 1 cut(s) 308
BseMII CTCAG 3 cut(s) 169, 252, 472
BseYI CCCAGC 1 cut(s) 228
Bsh1236I CGCG 2 cut(s) 155, 458
BshFI GGCC 1 cut(s) 287
BsiSI CCGG 1 cut(s) 214
BslI CCNNNNNNNGG 1 cut(s) 308
BsnI GGCC 1 cut(s) 287
BspANI GGCC 1 cut(s) 287
BspCNI CTCAG 3 cut(s) 170, 253, 473
BspFNI CGCG 2 cut(s) 155, 458
BstDEI CTNAG 4 cut(s) 178, 261, 297, 481
BstF5I GGATG 1 cut(s) 391
BstFNI CGCG 2 cut(s) 155, 458
BstHHI GCGC 2 cut(s) 155, 458
BstMWI GCNNNNNNNGC 1 cut(s) 318
BstNSI RCATGY 1 cut(s) 153
BstSCI CCNGG 1 cut(s) 213
BstUI CGCG 2 cut(s) 155, 458
BstV2I GAAGAC 1 cut(s) 81
BsuRI GGCC 1 cut(s) 287
BtsCI GGATG 1 cut(s) 391
BtsI GCAGTG 1 cut(s) 353
BtsIMutI CAGTG 1 cut(s) 353
CfoI GCGC 2 cut(s) 155, 458
CseI GACGC 1 cut(s) 447
CviAII CATG 3 cut(s) 150, 446, 509
CviJI RGCY 8 cut(s) 228, 246, 287, 301, 312, 408, 480, 536
CviKI_1 RGCY 8 cut(s) 228, 246, 287, 301, 312, 408, 480, 536
DdeI CTNAG 4 cut(s) 178, 261, 297, 481
Eco147I AGGCCT 1 cut(s) 287
EcoT22I ATGCAT 1 cut(s) 527
FaeI CATG 3 cut(s) 153, 449, 512
FalI AAGNNNNNCTT 2 cut(s) 445, 477
FatI CATG 3 cut(s) 149, 445, 508
FokI GGATG 1 cut(s) 398
FspBI CTAG 1 cut(s) 109
GlaI GCGC 2 cut(s) 154, 457
GsaI CCCAGC 1 cut(s) 232
HaeIII GGCC 1 cut(s) 287
HapII CCGG 1 cut(s) 214
HgaI GACGC 1 cut(s) 447
HhaI GCGC 2 cut(s) 155, 458
Hin1II CATG 3 cut(s) 153, 449, 512
Hin6I GCGC 2 cut(s) 153, 456
HinP1I GCGC 2 cut(s) 153, 456
HinfI GANTC 2 cut(s) 56, 512
HpaII CCGG 1 cut(s) 214
HphI GGTGA 1 cut(s) 83
Hpy188I TCNGA 1 cut(s) 262
HpyAV CCTTC 2 cut(s) 8, 479
HpyCH4V TGCA 2 cut(s) 41, 525
HpyF10VI GCNNNNNNNGC 1 cut(s) 318
HpyF3I CTNAG 4 cut(s) 178, 261, 297, 481
Hsp92II CATG 3 cut(s) 153, 449, 512
HspAI GCGC 2 cut(s) 153, 456
LmnI GCTCC 1 cut(s) 225
LpnPI CCDG 5 cut(s) 190, 214, 227, 301, 501
LweI GCATC 1 cut(s) 534
MaeI CTAG 1 cut(s) 109
MaeIII GTNAC 1 cut(s) 441
MboII GAAGA 3 cut(s) 65, 86, 194
MfeI CAATTG 1 cut(s) 42
MluCI AATT 2 cut(s) 42, 365
MmeI TCCRAC 1 cut(s) 250
MnlI CCTC 5 cut(s) 19, 256, 277, 385, 422
Mph1103I ATGCAT 1 cut(s) 527
MspI CCGG 1 cut(s) 214
MspR9I CCNGG 1 cut(s) 215
MunI CAATTG 1 cut(s) 42
MvnI CGCG 2 cut(s) 155, 458
MwoI GCNNNNNNNGC 1 cut(s) 318
NciI CCSGG 1 cut(s) 215
NlaIII CATG 3 cut(s) 153, 449, 512
NsiI ATGCAT 1 cut(s) 527
NspI RCATGY 1 cut(s) 153
PceI AGGCCT 1 cut(s) 287
PfeI GAWTC 2 cut(s) 56, 512
PspFI CCCAGC 1 cut(s) 228
ScrFI CCNGG 1 cut(s) 215
SetI ASST 6 cut(s) 163, 230, 248, 267, 414, 482
SfaNI GCATC 1 cut(s) 534
SpeI ACTAGT 1 cut(s) 108
Sse9I AATT 2 cut(s) 42, 365
SseBI AGGCCT 1 cut(s) 287
SspMI CTAG 1 cut(s) 109
StuI AGGCCT 1 cut(s) 287
StyD4I CCNGG 1 cut(s) 213
TaqI TCGA 2 cut(s) 166, 528
TasI AATT 2 cut(s) 42, 365
TfiI GAWTC 2 cut(s) 56, 512
TscAI CASTG 1 cut(s) 353
TspDTI ATGAA 1 cut(s) 48
TspGWI ACGGA 1 cut(s) 390
TspRI CASTG 1 cut(s) 353
XceI RCATGY 1 cut(s) 153
XspI CTAG 1 cut(s) 109
Zsp2I ATGCAT 1 cut(s) 527
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.