Rmu_sc0000601.1_g000001

Pentatricopeptide repeat-containing protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0000601.1
OG0014523
Physical Location & Seq
Reverse (-)
2 .. 944
943 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0000601.1_g000001.1.cds

Sequence Viewer

Length: 943 bp
atggcgaggaatgtgtttgtggctacctctttggttgatttgtatgccaagtgtggtaacatggagaaagcgcgtcttgtgtttgatggaatagctgagaaggatatagttgcttggagtagcatgattcagggatatgcatcgaatgggcttcctaaagaagcagtagacctcttctttcaaatgcagaaagagaacttgaaaccagattgttatgccatggtaggggtgctttctgcttgttctagattaggagctctagagctaggggagtgggctagcaatttggtggacaggaatgaaatttttatgaaccctgttcttggtacagctctgattgacatgtatgcgaaatgtgggagcatggtccaagcttgggaagtctttaaagggatgaagaggaaagaccatgtggtttggaatgcagcgatgtctggattagctatgaacggacatgtcaaagctgtgttcggactatttggacaagtggagaaatatggatttagagctaatgggaacactttcatgggcttgctttgtggatgttctcatgctggtctggttgatgagggtcgtagatatttcaataacatgaccagggtctattccttgacacctacgattgagcattatggatgtatggtagacctccttggccgtgcgggtttgttggatgaagcttatcagttgattgaaagtatggcaatgaaggcgaactctgttgtttggggagcgttgttgggtggatgtaggctgcatcgggatactcaattggctgaactggcactgaaacaactcattgagctcgaaccatggaactcagcacattatgttctcctctcaaatgtttactctgcaagtcagaaatgggatgaggcagccaacattagatcaagaatgaatgagcaagggctgcagaaaatcccaggttgcagctggatcg
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
DYW_deaminase PPR PPR_2

Protein Analysis

314

Amino Acids

34.82

Weight (kDa)

6.6

Isoelectric Point (pI)

27.92

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0014523)

Species Orthologous Gene IDs
arabidopsis_thaliana AT3G08820
fragaria_vesca FvH4_6g10271
malus_domestica MD04G1168200.v1.1 MD09G1180100.v1.1
prunus_persica Prupe.6G286400_v2.0.a1
pyrus_communis pycom04g01680 pycom04g14920
rosa_chinensis RchiOBHm_Chr3g0461021
rosa_laevigata RLG00000024957
rosa_multiflora Rmu_co8035226.1_g000001 Rmu_sc0000601.1_g000001 Rmu_sc0000601.1_g000002
rosa_rugosa Rorug03G0047900
rosa_samantha Rh3AG105200 Rh3BG109200 Rh3DG110900
rosa_wichuraiana Rw3G009010

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 2 cut(s) 168, 645
AccII CGCG 1 cut(s) 73
AciI CCGC 1 cut(s) 662
AcoI YGGCCR 1 cut(s) 655
AcsI RAATTY 1 cut(s) 303
AfaI GTAC 1 cut(s) 328
AfiI CCNNNNNNNGG 3 cut(s) 225, 323, 376
AflIII ACRYGT 2 cut(s) 342, 454
AgsI TTSAA 4 cut(s) 182, 202, 586, 695
AjnI CCWGG 2 cut(s) 596, 925
Alw21I GWGCWC 2 cut(s) 259, 807
AoxI GGCC 1 cut(s) 655
ApeKI GCWGC 5 cut(s) 425, 754, 878, 913, 933
ApoI RAATTY 1 cut(s) 303
Asp700I GAANNNNTTC 1 cut(s) 521
AspLEI GCGC 1 cut(s) 73
AspS9I GGNCC 1 cut(s) 367
AsuNHI GCTAGC 1 cut(s) 278
AvaII GGWCC 1 cut(s) 367
BanII GRGCYC 2 cut(s) 259, 807
Bbv12I GWGCWC 2 cut(s) 259, 807
BbvI GCAGC 4 cut(s) 437, 741, 890, 900
BccI CCATC 1 cut(s) 80
BceAI ACGGC 1 cut(s) 642
BcgI CGANNNNNNTGC 1 cut(s) 922
BciT130I CCWGG 2 cut(s) 598, 927
BciVI GTATCC 1 cut(s) 757
BfaI CTAG 4 cut(s) 246, 260, 266, 279
BfmI CTRYAG 1 cut(s) 914
BfuI GTATCC 1 cut(s) 757
BisI GCNGC 5 cut(s) 426, 755, 879, 914, 934
BlsI GCNGC 5 cut(s) 427, 756, 880, 915, 935
Bme1390I CCNGG 2 cut(s) 598, 927
Bme18I GGWCC 1 cut(s) 367
BmgT120I GGNCC 1 cut(s) 367
BmrFI CCNGG 2 cut(s) 598, 927
BmsI GCATC 2 cut(s) 149, 766
BmtI GCTAGC 1 cut(s) 282
BoxI GACNNNNGTC 1 cut(s) 599
BsaBI GATNNNNATC 1 cut(s) 139
BsaJI CCNNGG 5 cut(s) 219, 597, 652, 812, 925
Bsc4I CCNNNNNNNGG 3 cut(s) 225, 323, 376
Bse1I ACTGG 1 cut(s) 786
Bse3DI GCAATG 1 cut(s) 711
Bse8I GATNNNNATC 1 cut(s) 139
BseBI CCWGG 2 cut(s) 598, 927
BseDI CCNNGG 5 cut(s) 219, 597, 652, 812, 925
BseGI GGATG 6 cut(s) 399, 548, 641, 679, 752, 877
BseJI GATNNNNATC 1 cut(s) 139
BseLI CCNNNNNNNGG 3 cut(s) 225, 323, 376
BseMI GCAATG 1 cut(s) 711
BseMII CTCAG 2 cut(s) 87, 834
BseNI ACTGG 1 cut(s) 786
BseRI GAGGAG 1 cut(s) 827
BseXI GCAGC 4 cut(s) 437, 741, 890, 900
Bsh1236I CGCG 1 cut(s) 73
BshFI GGCC 1 cut(s) 657
BsiHKAI GWGCWC 2 cut(s) 259, 807
BslI CCNNNNNNNGG 3 cut(s) 225, 323, 376
BsmI GAATGC 1 cut(s) 427
BsnI GGCC 1 cut(s) 657
Bsp1286I GDGCHC 2 cut(s) 259, 807
Bsp143I GATC 2 cut(s) 890, 939
Bsp19I CCATGG 2 cut(s) 219, 812
BspACI CCGC 1 cut(s) 662
BspANI GGCC 1 cut(s) 657
BspCNI CTCAG 2 cut(s) 88, 833
BspFNI CGCG 1 cut(s) 73
BspMAI CTGCAG 1 cut(s) 918
BspOI GCTAGC 1 cut(s) 282
BsrDI GCAATG 1 cut(s) 711
BsrI ACTGG 1 cut(s) 786
BssECI CCNNGG 5 cut(s) 219, 597, 652, 812, 925
BssMI GATC 2 cut(s) 890, 939
BssT1I CCWWGG 3 cut(s) 219, 652, 812
Bst2UI CCWGG 2 cut(s) 598, 927
Bst6I CTCTTC 2 cut(s) 179, 392
BstAPI GCANNNNNTGC 1 cut(s) 913
BstC8I GCNNGC 2 cut(s) 280, 533
BstDEI CTNAG 2 cut(s) 96, 820
BstDSI CCRYGG 2 cut(s) 219, 812
BstF5I GGATG 6 cut(s) 399, 548, 641, 679, 752, 877
BstFNI CGCG 1 cut(s) 73
BstHHI GCGC 1 cut(s) 73
BstKTI GATC 2 cut(s) 893, 942
BstMBI GATC 2 cut(s) 890, 939
BstMWI GCNNNNNNNGC 3 cut(s) 710, 782, 913
BstNI CCWGG 2 cut(s) 598, 927
BstNSI RCATGY 2 cut(s) 346, 458
BstPAI GACNNNNGTC 1 cut(s) 599
BstSCI CCNGG 2 cut(s) 596, 925
BstSFI CTRYAG 1 cut(s) 914
BstUI CGCG 1 cut(s) 73
BstV1I GCAGC 4 cut(s) 437, 741, 890, 900
BsuI GTATCC 1 cut(s) 757
BsuRI GGCC 1 cut(s) 657
BtgI CCRYGG 2 cut(s) 219, 812
BtgZI GCGATG 1 cut(s) 443
BtsCI GGATG 6 cut(s) 399, 548, 641, 679, 752, 877
BtsIMutI CAGTG 1 cut(s) 785
Cac8I GCNNGC 2 cut(s) 280, 533
CfoI GCGC 1 cut(s) 73
Cfr13I GGNCC 1 cut(s) 367
CseI GACGC 1 cut(s) 62
Csp6I GTAC 1 cut(s) 327
CviQI GTAC 1 cut(s) 327
DdeI CTNAG 2 cut(s) 96, 820
DpnI GATC 2 cut(s) 892, 941
DpnII GATC 2 cut(s) 890, 939
DraI TTTAAA 1 cut(s) 388
EaeI YGGCCR 1 cut(s) 655
Eam1104I CTCTTC 2 cut(s) 179, 392
EarI CTCTTC 2 cut(s) 179, 392
Ecl136II GAGCTC 2 cut(s) 257, 805
Eco130I CCWWGG 3 cut(s) 219, 652, 812
Eco24I GRGCYC 2 cut(s) 259, 807
Eco47I GGWCC 1 cut(s) 367
Eco53kI GAGCTC 2 cut(s) 257, 805
EcoICRI GAGCTC 2 cut(s) 257, 805
EcoRII CCWGG 2 cut(s) 596, 925
EcoT14I CCWWGG 3 cut(s) 219, 652, 812
EcoT22I ATGCAT 1 cut(s) 142
EcoT38I GRGCYC 2 cut(s) 259, 807
ErhI CCWWGG 3 cut(s) 219, 652, 812
FalI AAGNNNNNCTT 2 cut(s) 60, 92
FauI CCCGC 1 cut(s) 655
FblI GTMKAC 2 cut(s) 168, 645
Fnu4HI GCNGC 5 cut(s) 426, 755, 879, 914, 934
FokI GGATG 6 cut(s) 406, 555, 648, 686, 759, 884
FriOI GRGCYC 2 cut(s) 259, 807
Fsp4HI GCNGC 5 cut(s) 426, 755, 879, 914, 934
FspBI CTAG 4 cut(s) 246, 260, 266, 279
GlaI GCGC 1 cut(s) 72
GluI GCNGC 5 cut(s) 426, 755, 879, 914, 934
HaeIII GGCC 1 cut(s) 657
HgaI GACGC 1 cut(s) 62
HhaI GCGC 1 cut(s) 73
Hin6I GCGC 1 cut(s) 71
HinP1I GCGC 1 cut(s) 71
HindIII AAGCTT 2 cut(s) 372, 678
HinfI GANTC 1 cut(s) 127
Hpy166II GTNNAC 4 cut(s) 169, 292, 646, 850
Hpy188I TCNGA 3 cut(s) 336, 473, 864
Hpy188III TCNNGA 5 cut(s) 246, 260, 435, 761, 894
Hpy8I GTNNAC 4 cut(s) 169, 292, 646, 850
HpyAV CCTTC 2 cut(s) 94, 703
HpyCH4V TGCA 7 cut(s) 140, 187, 425, 757, 857, 916, 933
HpyF10VI GCNNNNNNNGC 3 cut(s) 710, 782, 913
HpyF3I CTNAG 2 cut(s) 96, 820
HspAI GCGC 1 cut(s) 71
Kzo9I GATC 2 cut(s) 890, 939
LmnI GCTCC 3 cut(s) 254, 360, 731
Lsp1109I GCAGC 4 cut(s) 437, 741, 890, 900
LweI GCATC 2 cut(s) 149, 766
MaeI CTAG 4 cut(s) 246, 260, 266, 279
MaeIII GTNAC 1 cut(s) 56
MalI GATC 2 cut(s) 892, 941
MboI GATC 2 cut(s) 890, 939
MboII GAAGA 2 cut(s) 166, 409
MfeI CAATTG 1 cut(s) 770
MhlI GDGCHC 2 cut(s) 259, 807
MluCI AATT 3 cut(s) 283, 303, 770
MmeI TCCRAC 1 cut(s) 651
MnlI CCTC 7 cut(s) 37, 182, 393, 562, 659, 848, 868
Mph1103I ATGCAT 1 cut(s) 142
MroXI GAANNNNTTC 1 cut(s) 521
MseI TTAA 1 cut(s) 387
MslI CAYNNNNRTG 1 cut(s) 524
MspA1I CMGCKG 1 cut(s) 936
MspR9I CCNGG 2 cut(s) 598, 927
MunI CAATTG 1 cut(s) 770
Mva1269I GAATGC 1 cut(s) 427
MvaI CCWGG 2 cut(s) 598, 927
MvnI CGCG 1 cut(s) 73
MwoI GCNNNNNNNGC 3 cut(s) 710, 782, 913
NcoI CCATGG 2 cut(s) 219, 812
NdeII GATC 2 cut(s) 890, 939
NheI GCTAGC 1 cut(s) 278
NsiI ATGCAT 1 cut(s) 142
NspI RCATGY 2 cut(s) 346, 458
PciI ACATGT 2 cut(s) 342, 454
PctI GAATGC 1 cut(s) 427
PdmI GAANNNNTTC 1 cut(s) 521
PfeI GAWTC 1 cut(s) 127
PkrI GCNGC 5 cut(s) 427, 756, 880, 915, 935
PscI ACATGT 2 cut(s) 342, 454
PshAI GACNNNNGTC 1 cut(s) 599
Psp124BI GAGCTC 2 cut(s) 259, 807
Psp6I CCWGG 2 cut(s) 596, 925
PspGI CCWGG 2 cut(s) 596, 925
PspPI GGNCC 1 cut(s) 367
PstI CTGCAG 1 cut(s) 918
PvuII CAGCTG 1 cut(s) 936
RsaI GTAC 1 cut(s) 328
RsaNI GTAC 1 cut(s) 327
RseI CAYNNNNRTG 1 cut(s) 524
SacI GAGCTC 2 cut(s) 259, 807
SaqAI TTAA 1 cut(s) 387
SatI GCNGC 5 cut(s) 426, 755, 879, 914, 934
Sau3AI GATC 2 cut(s) 890, 939
Sau96I GGNCC 1 cut(s) 367
ScrFI CCNGG 2 cut(s) 598, 927
SduI GDGCHC 2 cut(s) 259, 807
SfaNI GCATC 2 cut(s) 149, 766
SfcI CTRYAG 1 cut(s) 914
SinI GGWCC 1 cut(s) 367
SmiMI CAYNNNNRTG 1 cut(s) 524
Sse9I AATT 3 cut(s) 283, 303, 770
SsiI CCGC 1 cut(s) 662
SspMI CTAG 4 cut(s) 246, 260, 266, 279
SstI GAGCTC 2 cut(s) 259, 807
StyD4I CCNGG 2 cut(s) 596, 925
StyI CCWWGG 3 cut(s) 219, 652, 812
TaqI TCGA 2 cut(s) 143, 807
TasI AATT 3 cut(s) 283, 303, 770
TfiI GAWTC 1 cut(s) 127
Tru1I TTAA 1 cut(s) 387
Tru9I TTAA 1 cut(s) 387
TscAI CASTG 1 cut(s) 792
TseI GCWGC 5 cut(s) 425, 754, 878, 913, 933
TspDTI ATGAA 8 cut(s) 315, 326, 410, 461, 514, 690, 722, 914
TspGWI ACGGA 1 cut(s) 465
TspRI CASTG 1 cut(s) 792
VpaK11BI GGWCC 1 cut(s) 367
XapI RAATTY 1 cut(s) 303
XbaI TCTAGA 2 cut(s) 245, 259
XceI RCATGY 2 cut(s) 346, 458
XcmI CCANNNNNNNNNTGG 1 cut(s) 933
XmiI GTMKAC 2 cut(s) 168, 645
XmnI GAANNNNTTC 1 cut(s) 521
XspI CTAG 4 cut(s) 246, 260, 266, 279
Zsp2I ATGCAT 1 cut(s) 142
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.