Rmu_co8050104.1_g000001

Ribosomal RNA large subunit methyltransferase

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co8050104.1
OG0011170
Physical Location & Seq
Reverse (-)
2 .. 542
541 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co8050104.1_g000001.1.cds

Sequence Viewer

Length: 266 bp
atgagtggggcaggaaagccggactttttctacagagaagctcagcgcctgggttatgtagctcgctccgccttcaaggtaatacagaagcagtacaagctcataacaccaggctcctctgttctggaccttggttgtgctcctggtgcttggcttcaggtggcttgtcagagcttgggtcctatcaaaaatggtggtcttgttgttgggattgatctcaagaaggtgaaggttccagctatgcattgtgattcaagggttcaaac
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
FtsJ

Protein Analysis

89

Amino Acids

9.57

Weight (kDa)

9.67

Isoelectric Point (pI)

41.84

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0011170)

Species Orthologous Gene IDs
arabidopsis_thaliana AT5G13830
fragaria_vesca FvH4_7g22770
malus_domestica MD07G1200600.v1.1
prunus_persica Prupe.2G237400_v2.0.a1
pyrus_communis pycom01g15670 pycom07g18760 pycom07g18770
rosa_chinensis RchiOBHm_Chr1g0367871
rosa_laevigata RLG00000027260
rosa_multiflora Rmu_co8050104.1_g000001 Rmu_sc0010008.1_g000001 Rmu_ssc0000395.1_g000039
rosa_roxburghii Rroxscaffold_4G00289170
rosa_rugosa Rorug01G0337300 Rorug01G0337400
rosa_samantha Rh1AG344200 Rh1BG306200 Rh1CG321800 Rh1DG338400
rosa_wichuraiana Rw1G030640

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 69
AcuI CTGAAG 1 cut(s) 140
AfaI GTAC 1 cut(s) 95
AgsI TTSAA 3 cut(s) 76, 255, 263
AjnI CCWGG 3 cut(s) 48, 109, 142
AluBI AGCT 5 cut(s) 41, 62, 100, 174, 239
AluI AGCT 5 cut(s) 41, 62, 100, 174, 239
Alw21I GWGCWC 1 cut(s) 142
AlwNI CAGNNNCTG 1 cut(s) 49
AspLEI GCGC 1 cut(s) 48
AspS9I GGNCC 2 cut(s) 127, 179
AsuHPI GGTGA 1 cut(s) 238
AvaII GGWCC 2 cut(s) 127, 179
Bbv12I GWGCWC 1 cut(s) 142
BciT130I CCWGG 3 cut(s) 50, 111, 144
BfmI CTRYAG 1 cut(s) 31
BfoI RGCGCY 1 cut(s) 49
BlpI GCTNAGC 1 cut(s) 42
Bme1390I CCNGG 3 cut(s) 50, 111, 144
Bme18I GGWCC 2 cut(s) 127, 179
BmgT120I GGNCC 2 cut(s) 127, 179
BmiI GGNNCC 3 cut(s) 115, 180, 234
BmrFI CCNGG 3 cut(s) 50, 111, 144
Bpu1102I GCTNAGC 1 cut(s) 42
BpuEI CTTGAG 1 cut(s) 203
BsaJI CCNNGG 2 cut(s) 49, 130
BseBI CCWGG 3 cut(s) 50, 111, 144
BseDI CCNNGG 2 cut(s) 49, 130
BseMII CTCAG 1 cut(s) 56
BseRI GAGGAG 1 cut(s) 106
BsiHKAI GWGCWC 1 cut(s) 142
BsiSI CCGG 1 cut(s) 20
Bsp1286I GDGCHC 1 cut(s) 142
Bsp143I GATC 1 cut(s) 214
Bsp1720I GCTNAGC 1 cut(s) 42
BspACI CCGC 1 cut(s) 69
BspCNI CTCAG 1 cut(s) 55
BspLI GGNNCC 3 cut(s) 115, 180, 234
BssECI CCNNGG 2 cut(s) 49, 130
BssMI GATC 1 cut(s) 214
BssT1I CCWWGG 1 cut(s) 130
Bst2UI CCWGG 3 cut(s) 50, 111, 144
BstC8I GCNNGC 1 cut(s) 64
BstDEI CTNAG 1 cut(s) 42
BstH2I RGCGCY 1 cut(s) 49
BstHHI GCGC 1 cut(s) 48
BstKTI GATC 1 cut(s) 217
BstMBI GATC 1 cut(s) 214
BstMWI GCNNNNNNNGC 3 cut(s) 68, 97, 146
BstNI CCWGG 3 cut(s) 50, 111, 144
BstSCI CCNGG 3 cut(s) 48, 109, 142
BstSFI CTRYAG 1 cut(s) 31
Cac8I GCNNGC 1 cut(s) 64
CaiI CAGNNNCTG 1 cut(s) 49
CfoI GCGC 1 cut(s) 48
Cfr13I GGNCC 2 cut(s) 127, 179
Csp6I GTAC 1 cut(s) 94
CspCI CAANNNNNGTGG 2 cut(s) 175, 210
CviJI RGCY 9 cut(s) 19, 41, 62, 100, 114, 154, 164, 174, 239
CviKI_1 RGCY 9 cut(s) 19, 41, 62, 100, 114, 154, 164, 174, 239
CviQI GTAC 1 cut(s) 94
DdeI CTNAG 1 cut(s) 42
DpnI GATC 1 cut(s) 216
DpnII GATC 1 cut(s) 214
EciI GGCGGA 1 cut(s) 58
Eco130I CCWWGG 1 cut(s) 130
Eco47I GGWCC 2 cut(s) 127, 179
Eco57I CTGAAG 1 cut(s) 140
EcoO109I RGGNCCY 1 cut(s) 179
EcoRII CCWGG 3 cut(s) 48, 109, 142
EcoT14I CCWWGG 1 cut(s) 130
EcoT22I ATGCAT 1 cut(s) 246
ErhI CCWWGG 1 cut(s) 130
FaiI YATR 3 cut(s) 57, 104, 242
FalI AAGNNNNNCTT 2 cut(s) 8, 40
GlaI GCGC 1 cut(s) 47
HaeII RGCGCY 1 cut(s) 49
HapII CCGG 1 cut(s) 20
HhaI GCGC 1 cut(s) 48
Hin6I GCGC 1 cut(s) 46
HinP1I GCGC 1 cut(s) 46
HinfI GANTC 1 cut(s) 251
HpaII CCGG 1 cut(s) 20
HphI GGTGA 1 cut(s) 238
Hpy188I TCNGA 1 cut(s) 171
Hpy188III TCNNGA 2 cut(s) 125, 220
HpyAV CCTTC 3 cut(s) 82, 217, 223
HpyCH4V TGCA 1 cut(s) 244
HpyF10VI GCNNNNNNNGC 3 cut(s) 68, 97, 146
HpyF3I CTNAG 1 cut(s) 42
HspAI GCGC 1 cut(s) 46
Kzo9I GATC 1 cut(s) 214
LmnI GCTCC 3 cut(s) 71, 119, 145
MalI GATC 1 cut(s) 216
MboI GATC 1 cut(s) 214
MhlI GDGCHC 1 cut(s) 142
MnlI CCTC 1 cut(s) 127
Mph1103I ATGCAT 1 cut(s) 246
MspI CCGG 1 cut(s) 20
MspR9I CCNGG 3 cut(s) 50, 111, 144
MvaI CCWGG 3 cut(s) 50, 111, 144
MwoI GCNNNNNNNGC 3 cut(s) 68, 97, 146
NdeII GATC 1 cut(s) 214
NlaIV GGNNCC 3 cut(s) 115, 180, 234
NsiI ATGCAT 1 cut(s) 246
PfeI GAWTC 1 cut(s) 251
PpuMI RGGWCCY 1 cut(s) 179
Psp5II RGGWCCY 1 cut(s) 179
Psp6I CCWGG 3 cut(s) 48, 109, 142
PspGI CCWGG 3 cut(s) 48, 109, 142
PspN4I GGNNCC 3 cut(s) 115, 180, 234
PspPI GGNCC 2 cut(s) 127, 179
PspPPI RGGWCCY 1 cut(s) 179
PstNI CAGNNNCTG 1 cut(s) 49
RsaI GTAC 1 cut(s) 95
RsaNI GTAC 1 cut(s) 94
Sau3AI GATC 1 cut(s) 214
Sau96I GGNCC 2 cut(s) 127, 179
ScrFI CCNGG 3 cut(s) 50, 111, 144
SduI GDGCHC 1 cut(s) 142
SfcI CTRYAG 1 cut(s) 31
SinI GGWCC 2 cut(s) 127, 179
SmlI CTYRAG 1 cut(s) 218
SmoI CTYRAG 1 cut(s) 218
SsiI CCGC 1 cut(s) 69
StyD4I CCNGG 3 cut(s) 48, 109, 142
StyI CCWWGG 1 cut(s) 130
TatI WGTACW 1 cut(s) 93
TfiI GAWTC 1 cut(s) 251
VpaK11BI GGWCC 2 cut(s) 127, 179
Zsp2I ATGCAT 1 cut(s) 246
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.