Rmu_co8052378.1_g000001

No description available

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co8052378.1
Physical Location & Seq
Forward (+)
1 .. 562
562 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co8052378.1_g000001.1.cds

Sequence Viewer

Length: 447 bp
gggtttacttggatagaggagactttggtaaagtttggaactttggtggtttgcaggagatagtggacctaccaacaaaagcgaatgaatccagtagaggccagaatgcagcgaaggatgagttaaccgtgtctgagcttttaaatgtagaactaagatggacttctaagtcggagaaatccggggctgggctttcggatgagaaggctcccactcggcctaaaagttttctggatttggctggagtgaatctggacaacttcttttcggaaggagagaaagatgctgctttgaatgcatctgaagagccgtttgagccgagctctcagactgcaactacagagactagtgctttcaaacctagtgaaaatcttagtttgtttgcatcagaagagccgtttgagccgaacaaaccaattgccactacagagactagtgctttcaaag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

148

Amino Acids

16.1

Weight (kDa)

4.48

Isoelectric Point (pI)

46.22

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AasI GACNNNNNNGTC 1 cut(s) 168
AcuI CTGAAG 1 cut(s) 323
AfiI CCNNNNNNNGG 1 cut(s) 188
AgsI TTSAA 3 cut(s) 294, 357, 444
AhlI ACTAGT 2 cut(s) 346, 433
AluBI AGCT 2 cut(s) 138, 323
AluI AGCT 2 cut(s) 138, 323
Alw21I GWGCWC 1 cut(s) 325
Alw26I GTCTC 3 cut(s) 14, 337, 424
AoxI GGCC 2 cut(s) 99, 217
ApeKI GCWGC 2 cut(s) 109, 286
AspS9I GGNCC 1 cut(s) 66
AsuC2I CCSGG 1 cut(s) 183
AvaII GGWCC 1 cut(s) 66
BanII GRGCYC 1 cut(s) 325
Bbv12I GWGCWC 1 cut(s) 325
BbvI GCAGC 2 cut(s) 121, 273
BccI CCATC 1 cut(s) 152
BceAI ACGGC 2 cut(s) 294, 381
BcnI CCSGG 1 cut(s) 183
BcoDI GTCTC 3 cut(s) 14, 337, 424
BcuI ACTAGT 2 cut(s) 346, 433
BfaI CTAG 3 cut(s) 347, 362, 434
BfmI CTRYAG 2 cut(s) 338, 425
BisI GCNGC 2 cut(s) 110, 287
BlsI GCNGC 2 cut(s) 111, 288
Bme1390I CCNGG 1 cut(s) 183
Bme18I GGWCC 1 cut(s) 66
BmgT120I GGNCC 1 cut(s) 66
BmiI GGNNCC 1 cut(s) 209
BmrFI CCNGG 1 cut(s) 183
BmsI GCATC 3 cut(s) 273, 307, 394
BplI GAGNNNNNCTC 2 cut(s) 307, 339
BpmI CTGGAG 1 cut(s) 263
BpuMI CCSGG 1 cut(s) 183
BsaJI CCNNGG 1 cut(s) 182
Bsc4I CCNNNNNNNGG 1 cut(s) 188
Bse1I ACTGG 1 cut(s) 92
BseDI CCNNGG 1 cut(s) 182
BseGI GGATG 2 cut(s) 123, 204
BseLI CCNNNNNNNGG 1 cut(s) 188
BseMII CTCAG 2 cut(s) 125, 340
BseNI ACTGG 1 cut(s) 92
BseRI GAGGAG 1 cut(s) 32
BseXI GCAGC 2 cut(s) 121, 273
BseYI CCCAGC 1 cut(s) 187
BshFI GGCC 2 cut(s) 101, 219
BsiHKAI GWGCWC 1 cut(s) 325
BsiSI CCGG 1 cut(s) 182
BslI CCNNNNNNNGG 1 cut(s) 188
BsmAI GTCTC 3 cut(s) 14, 337, 424
BsmI GAATGC 2 cut(s) 111, 300
BsnI GGCC 2 cut(s) 101, 219
Bsp1286I GDGCHC 1 cut(s) 325
BspANI GGCC 2 cut(s) 101, 219
BspCNI CTCAG 2 cut(s) 126, 339
BspLI GGNNCC 1 cut(s) 209
BspQI GCTCTTC 2 cut(s) 299, 386
BsrI ACTGG 1 cut(s) 92
BssECI CCNNGG 1 cut(s) 182
Bst4CI ACNGT 1 cut(s) 129
Bst6I CTCTTC 2 cut(s) 299, 386
BstDEI CTNAG 5 cut(s) 134, 154, 167, 326, 373
BstF5I GGATG 2 cut(s) 123, 204
BstMAI GTCTC 3 cut(s) 14, 337, 424
BstMWI GCNNNNNNNGC 3 cut(s) 295, 315, 402
BstSCI CCNGG 1 cut(s) 181
BstSFI CTRYAG 2 cut(s) 338, 425
BstV1I GCAGC 2 cut(s) 121, 273
BsuRI GGCC 2 cut(s) 101, 219
BtsCI GGATG 2 cut(s) 123, 204
Cfr13I GGNCC 1 cut(s) 66
DdeI CTNAG 5 cut(s) 134, 154, 167, 326, 373
DraI TTTAAA 1 cut(s) 143
DrdI GACNNNNNNGTC 1 cut(s) 168
DseDI GACNNNNNNGTC 1 cut(s) 168
Eam1104I CTCTTC 2 cut(s) 299, 386
EarI CTCTTC 2 cut(s) 299, 386
Ecl136II GAGCTC 1 cut(s) 323
Eco24I GRGCYC 1 cut(s) 325
Eco47I GGWCC 1 cut(s) 66
Eco53kI GAGCTC 1 cut(s) 323
Eco57I CTGAAG 1 cut(s) 323
EcoICRI GAGCTC 1 cut(s) 323
EcoT22I ATGCAT 1 cut(s) 300
EcoT38I GRGCYC 1 cut(s) 325
FalI AAGNNNNNCTT 2 cut(s) 147, 179
Fnu4HI GCNGC 2 cut(s) 110, 287
FokI GGATG 2 cut(s) 130, 211
FriOI GRGCYC 1 cut(s) 325
Fsp4HI GCNGC 2 cut(s) 110, 287
FspBI CTAG 3 cut(s) 347, 362, 434
GluI GCNGC 2 cut(s) 110, 287
GsaI CCCAGC 1 cut(s) 191
GsuI CTGGAG 1 cut(s) 263
HaeIII GGCC 2 cut(s) 101, 219
HapII CCGG 1 cut(s) 182
HincII GTYRAC 1 cut(s) 125
HindII GTYRAC 1 cut(s) 125
HinfI GANTC 2 cut(s) 88, 249
HpaI GTTAAC 1 cut(s) 125
HpaII CCGG 1 cut(s) 182
Hpy166II GTNNAC 3 cut(s) 6, 66, 125
Hpy188I TCNGA 7 cut(s) 135, 174, 198, 270, 303, 329, 390
Hpy188III TCNNGA 2 cut(s) 232, 253
Hpy8I GTNNAC 3 cut(s) 6, 66, 125
HpyAV CCTTC 3 cut(s) 108, 198, 265
HpyCH4III ACNGT 1 cut(s) 129
HpyCH4V TGCA 5 cut(s) 54, 109, 298, 334, 385
HpyF10VI GCNNNNNNNGC 3 cut(s) 295, 315, 402
HpyF3I CTNAG 5 cut(s) 134, 154, 167, 326, 373
KspAI GTTAAC 1 cut(s) 125
LguI GCTCTTC 2 cut(s) 299, 386
LmnI GCTCC 1 cut(s) 213
LpnPI CCDG 8 cut(s) 40, 105, 115, 173, 195, 217, 227, 238
Lsp1109I GCAGC 2 cut(s) 121, 273
LweI GCATC 3 cut(s) 273, 307, 394
MaeI CTAG 3 cut(s) 347, 362, 434
MboII GAAGA 2 cut(s) 316, 403
MfeI CAATTG 1 cut(s) 416
MhlI GDGCHC 1 cut(s) 325
MluCI AATT 1 cut(s) 416
MmeI TCCRAC 1 cut(s) 152
MnlI CCTC 2 cut(s) 10, 91
Mph1103I ATGCAT 1 cut(s) 300
MseI TTAA 2 cut(s) 124, 142
MspI CCGG 1 cut(s) 182
MspR9I CCNGG 1 cut(s) 183
MunI CAATTG 1 cut(s) 416
Mva1269I GAATGC 2 cut(s) 111, 300
MwoI GCNNNNNNNGC 3 cut(s) 295, 315, 402
NciI CCSGG 1 cut(s) 183
NlaIV GGNNCC 1 cut(s) 209
NmeAIII GCCGAG 2 cut(s) 195, 344
NsiI ATGCAT 1 cut(s) 300
PciSI GCTCTTC 2 cut(s) 299, 386
PctI GAATGC 2 cut(s) 111, 300
PfeI GAWTC 2 cut(s) 88, 249
PkrI GCNGC 2 cut(s) 111, 288
Psp124BI GAGCTC 1 cut(s) 325
PspFI CCCAGC 1 cut(s) 187
PspN4I GGNNCC 1 cut(s) 209
PspPI GGNCC 1 cut(s) 66
SacI GAGCTC 1 cut(s) 325
SapI GCTCTTC 2 cut(s) 299, 386
SaqAI TTAA 2 cut(s) 124, 142
SatI GCNGC 2 cut(s) 110, 287
Sau96I GGNCC 1 cut(s) 66
ScrFI CCNGG 1 cut(s) 183
SduI GDGCHC 1 cut(s) 325
SetI ASST 4 cut(s) 71, 140, 325, 363
SfaNI GCATC 3 cut(s) 273, 307, 394
SfcI CTRYAG 2 cut(s) 338, 425
SinI GGWCC 1 cut(s) 66
SpeI ACTAGT 2 cut(s) 346, 433
Sse9I AATT 1 cut(s) 416
SspMI CTAG 3 cut(s) 347, 362, 434
SstI GAGCTC 1 cut(s) 325
StyD4I CCNGG 1 cut(s) 181
TaaI ACNGT 1 cut(s) 129
TasI AATT 1 cut(s) 416
TfiI GAWTC 2 cut(s) 88, 249
Tru1I TTAA 2 cut(s) 124, 142
Tru9I TTAA 2 cut(s) 124, 142
TseI GCWGC 2 cut(s) 109, 286
TspDTI ATGAA 1 cut(s) 101
VpaK11BI GGWCC 1 cut(s) 66
XspI CTAG 3 cut(s) 347, 362, 434
Zsp2I ATGCAT 1 cut(s) 300
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.