Rmu_co8068106.1_g000001

Vitamin B6 photo-protection and homoeostasis

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co8068106.1
Physical Location & Seq
Forward (+)
1 .. 494
494 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co8068106.1_g000001.1.cds

Sequence Viewer

Length: 226 bp
atgggtttcgaaagatggaataggagctgttggacgcttatttatcggtgggcgatttgggaatctttttgatgatgatccaaagcagtggcgcttatatgcagacttcattggcagtgcaggaagcatttttgatcttactacaccattgtatcctgcctatttcctgccattggcatctcttggaaatcttaccaaggtatccccctgccatgtatttatgtag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

74

Amino Acids

8.14

Weight (kDa)

6.75

Isoelectric Point (pI)

27.26

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0012199)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 72
AfiI CCNNNNNNNGG 1 cut(s) 173
AluBI AGCT 1 cut(s) 27
AluI AGCT 1 cut(s) 27
AlwI GGATC 1 cut(s) 72
AspLEI GCGC 1 cut(s) 94
AsuII TTCGAA 1 cut(s) 9
BaeI ACNNNNGTAYC 4 cut(s) 135, 168, 184, 217
BccI CCATC 1 cut(s) 9
BciVI GTATCC 2 cut(s) 163, 212
BfoI RGCGCY 1 cut(s) 95
BfuI GTATCC 2 cut(s) 163, 212
BmsI GCATC 1 cut(s) 186
Bpu14I TTCGAA 1 cut(s) 9
BsaBI GATNNNNATC 1 cut(s) 76
BsaJI CCNNGG 1 cut(s) 196
Bsc4I CCNNNNNNNGG 1 cut(s) 173
Bse8I GATNNNNATC 1 cut(s) 76
BseDI CCNNGG 1 cut(s) 196
BseJI GATNNNNATC 1 cut(s) 76
BseLI CCNNNNNNNGG 1 cut(s) 173
BsgI GTGCAG 1 cut(s) 139
BslI CCNNNNNNNGG 1 cut(s) 173
Bsp119I TTCGAA 1 cut(s) 9
Bsp143I GATC 2 cut(s) 77, 134
BspPI GGATC 1 cut(s) 72
BspT104I TTCGAA 1 cut(s) 9
BssECI CCNNGG 1 cut(s) 196
BssMI GATC 2 cut(s) 77, 134
BssT1I CCWWGG 1 cut(s) 196
BstBI TTCGAA 1 cut(s) 9
BstH2I RGCGCY 1 cut(s) 95
BstHHI GCGC 1 cut(s) 94
BstKTI GATC 2 cut(s) 80, 137
BstMBI GATC 2 cut(s) 77, 134
BstXI CCANNNNNNTGG 1 cut(s) 88
BsuI GTATCC 2 cut(s) 163, 212
BtsI GCAGTG 2 cut(s) 93, 122
BtsIMutI CAGTG 2 cut(s) 93, 122
CfoI GCGC 1 cut(s) 94
CseI GACGC 1 cut(s) 43
CviAII CATG 1 cut(s) 213
CviJI RGCY 1 cut(s) 27
CviKI_1 RGCY 1 cut(s) 27
DpnI GATC 2 cut(s) 79, 136
DpnII GATC 2 cut(s) 77, 134
Eco130I CCWWGG 1 cut(s) 196
EcoT14I CCWWGG 1 cut(s) 196
ErhI CCWWGG 1 cut(s) 196
FaeI CATG 1 cut(s) 216
FaiI YATR 4 cut(s) 98, 100, 214, 222
FatI CATG 1 cut(s) 212
GlaI GCGC 1 cut(s) 93
HaeII RGCGCY 1 cut(s) 95
HgaI GACGC 1 cut(s) 43
HhaI GCGC 1 cut(s) 94
Hin1II CATG 1 cut(s) 216
Hin6I GCGC 1 cut(s) 92
HinP1I GCGC 1 cut(s) 92
HinfI GANTC 1 cut(s) 62
HpyCH4V TGCA 2 cut(s) 102, 120
Hsp92II CATG 1 cut(s) 216
HspAI GCGC 1 cut(s) 92
Kzo9I GATC 2 cut(s) 77, 134
LmnI GCTCC 1 cut(s) 24
LpnPI CCDG 4 cut(s) 106, 169, 180, 221
LweI GCATC 1 cut(s) 186
MalI GATC 2 cut(s) 79, 136
MboI GATC 2 cut(s) 77, 134
MmeI TCCRAC 1 cut(s) 11
NdeII GATC 2 cut(s) 77, 134
NlaIII CATG 1 cut(s) 216
NspV TTCGAA 1 cut(s) 9
PfeI GAWTC 1 cut(s) 62
Sau3AI GATC 2 cut(s) 77, 134
SetI ASST 2 cut(s) 29, 202
SfaNI GCATC 1 cut(s) 186
SfuI TTCGAA 1 cut(s) 9
SgeI CNNG 6 cut(s) 133, 168, 179, 195, 209, 220
StyI CCWWGG 1 cut(s) 196
TaqI TCGA 1 cut(s) 9
TfiI GAWTC 1 cut(s) 62
TscAI CASTG 2 cut(s) 93, 122
TspDTI ATGAA 1 cut(s) 98
TspRI CASTG 2 cut(s) 93, 122
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.