Rmu_co8190904.1_g000001

Vitamin B6 photo-protection and homoeostasis

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co8190904.1
Physical Location & Seq
Reverse (-)
236 .. 472
237 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co8190904.1_g000001.1.cds

Sequence Viewer

Length: 237 bp
atgcaggtgggagcttcaagtatgtcagttttacgaagtttgtggcaagcttattggttacatgagaactggaatagctcaagtactgccctcaaacagcttgcacaaagccgtttggagatggaagataggtttgaggacttcatccaacagttgaatggaattggatgggatacacttcaaattaacctgaaggttcccaaggaaatttccctcgatgaattgaaccccatttga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

78

Amino Acids

9.05

Weight (kDa)

4.68

Isoelectric Point (pI)

49.18

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0012199)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 207
AcuI CTGAAG 1 cut(s) 212
AfaI GTAC 1 cut(s) 85
AgsI TTSAA 4 cut(s) 18, 157, 182, 226
AluBI AGCT 4 cut(s) 14, 50, 78, 100
AluI AGCT 4 cut(s) 14, 50, 78, 100
ApoI RAATTY 1 cut(s) 207
BccI CCATC 2 cut(s) 115, 162
BceAI ACGGC 1 cut(s) 96
BciVI GTATCC 1 cut(s) 166
BfuI GTATCC 1 cut(s) 166
BmcAI AGTACT 1 cut(s) 85
BmiI GGNNCC 1 cut(s) 198
BpuEI CTTGAG 1 cut(s) 64
BsaJI CCNNGG 1 cut(s) 201
Bse1I ACTGG 1 cut(s) 74
BseDI CCNNGG 1 cut(s) 201
BseGI GGATG 2 cut(s) 144, 173
BseNI ACTGG 1 cut(s) 74
BspLI GGNNCC 1 cut(s) 198
BsrI ACTGG 1 cut(s) 74
BssECI CCNNGG 1 cut(s) 201
BssT1I CCWWGG 1 cut(s) 201
Bst4CI ACNGT 1 cut(s) 153
BstC8I GCNNGC 2 cut(s) 48, 102
BstF5I GGATG 2 cut(s) 144, 173
BsuI GTATCC 1 cut(s) 166
BtsCI GGATG 2 cut(s) 144, 173
Cac8I GCNNGC 2 cut(s) 48, 102
Csp6I GTAC 1 cut(s) 84
CviAII CATG 1 cut(s) 62
CviJI RGCY 5 cut(s) 14, 50, 78, 100, 111
CviKI_1 RGCY 5 cut(s) 14, 50, 78, 100, 111
CviQI GTAC 1 cut(s) 84
Eco130I CCWWGG 1 cut(s) 201
Eco57I CTGAAG 1 cut(s) 212
EcoT14I CCWWGG 1 cut(s) 201
ErhI CCWWGG 1 cut(s) 201
FaeI CATG 1 cut(s) 65
FaiI YATR 2 cut(s) 23, 63
FatI CATG 1 cut(s) 61
FokI GGATG 2 cut(s) 131, 180
Hin1II CATG 1 cut(s) 65
HindIII AAGCTT 1 cut(s) 48
HpyAV CCTTC 1 cut(s) 187
HpyCH4III ACNGT 1 cut(s) 153
HpyCH4V TGCA 2 cut(s) 4, 104
Hsp92II CATG 1 cut(s) 65
LmnI GCTCC 1 cut(s) 11
LpnPI CCDG 2 cut(s) 55, 203
MaeIII GTNAC 1 cut(s) 57
MboII GAAGA 1 cut(s) 137
MluCI AATT 4 cut(s) 162, 183, 207, 221
MmeI TCCRAC 1 cut(s) 172
MnlI CCTC 3 cut(s) 101, 130, 224
MseI TTAA 1 cut(s) 186
NlaIII CATG 1 cut(s) 65
NlaIV GGNNCC 1 cut(s) 198
PspN4I GGNNCC 1 cut(s) 198
RsaI GTAC 1 cut(s) 85
RsaNI GTAC 1 cut(s) 84
SaqAI TTAA 1 cut(s) 186
ScaI AGTACT 1 cut(s) 85
SetI ASST 8 cut(s) 9, 16, 52, 80, 102, 134, 192, 198
SmlI CTYRAG 1 cut(s) 79
SmoI CTYRAG 1 cut(s) 79
Sse9I AATT 4 cut(s) 162, 183, 207, 221
StyI CCWWGG 1 cut(s) 201
TaaI ACNGT 1 cut(s) 153
TaqI TCGA 1 cut(s) 216
TasI AATT 4 cut(s) 162, 183, 207, 221
TatI WGTACW 1 cut(s) 83
Tru1I TTAA 1 cut(s) 186
Tru9I TTAA 1 cut(s) 186
TspDTI ATGAA 2 cut(s) 133, 234
XapI RAATTY 1 cut(s) 207
XcmI CCANNNNNNNNNTGG 1 cut(s) 155
ZrmI AGTACT 1 cut(s) 85
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.