Rmu_co8070424.1_g000001

Prolyl 4-hydroxylase alpha subunit homologues.

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co8070424.1
Physical Location & Seq
Forward (+)
1 .. 423
423 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co8070424.1_g000001.1.cds

Sequence Viewer

Length: 195 bp
tttgcttcatttttgctgtatctatctaatgtagaagaaggtggagaaacaatgtttccttttgagaacggttcaaatatggatattagatatgattacaagaaatgcattggtctaaaagttaagccaaggcaaggggatggacttttattttattcggtgcttccaaatggcacaattgatcaggtgatttga
Functional Annotation

Protein Analysis

64

Amino Acids

7.24

Weight (kDa)

4.77

Isoelectric Point (pI)

22.68

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0010783)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AfiI CCNNNNNNNGG 1 cut(s) 134
AgsI TTSAA 1 cut(s) 75
BccI CCATC 1 cut(s) 134
BclI TGATCA 1 cut(s) 181
BsaJI CCNNGG 1 cut(s) 128
Bsc4I CCNNNNNNNGG 1 cut(s) 134
BseDI CCNNGG 1 cut(s) 128
BseGI GGATG 1 cut(s) 145
BseLI CCNNNNNNNGG 1 cut(s) 134
BslI CCNNNNNNNGG 1 cut(s) 134
Bsp143I GATC 1 cut(s) 181
BssECI CCNNGG 1 cut(s) 128
BssMI GATC 1 cut(s) 181
BssT1I CCWWGG 1 cut(s) 128
Bst4CI ACNGT 1 cut(s) 71
BstF5I GGATG 1 cut(s) 145
BstKTI GATC 1 cut(s) 184
BstMBI GATC 1 cut(s) 181
BtsCI GGATG 1 cut(s) 145
CviJI RGCY 1 cut(s) 127
CviKI_1 RGCY 1 cut(s) 127
DpnI GATC 1 cut(s) 183
DpnII GATC 1 cut(s) 181
Eco130I CCWWGG 1 cut(s) 128
EcoT14I CCWWGG 1 cut(s) 128
EcoT22I ATGCAT 1 cut(s) 110
ErhI CCWWGG 1 cut(s) 128
FaiI YATR 2 cut(s) 80, 93
FbaI TGATCA 1 cut(s) 181
FokI GGATG 1 cut(s) 152
HpyAV CCTTC 1 cut(s) 32
HpyCH4III ACNGT 1 cut(s) 71
HpyCH4V TGCA 1 cut(s) 108
Ksp22I TGATCA 1 cut(s) 181
Kzo9I GATC 1 cut(s) 181
LpnPI CCDG 1 cut(s) 170
MalI GATC 1 cut(s) 183
MboI GATC 1 cut(s) 181
MboII GAAGA 1 cut(s) 47
MfeI CAATTG 1 cut(s) 177
MluCI AATT 1 cut(s) 177
Mph1103I ATGCAT 1 cut(s) 110
MseI TTAA 1 cut(s) 123
MunI CAATTG 1 cut(s) 177
NdeII GATC 1 cut(s) 181
NsiI ATGCAT 1 cut(s) 110
SaqAI TTAA 1 cut(s) 123
Sau3AI GATC 1 cut(s) 181
SetI ASST 2 cut(s) 43, 189
SgeI CNNG 3 cut(s) 112, 141, 146
Sse9I AATT 1 cut(s) 177
StyI CCWWGG 1 cut(s) 128
TaaI ACNGT 1 cut(s) 71
TasI AATT 1 cut(s) 177
Tru1I TTAA 1 cut(s) 123
Tru9I TTAA 1 cut(s) 123
Zsp2I ATGCAT 1 cut(s) 110
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.