Rmu_co8091094.1_g000001

phosphatase 2C

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co8091094.1
Physical Location & Seq
Reverse (-)
1 .. 253
253 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co8091094.1_g000001.1.cds

Sequence Viewer

Length: 188 bp
atgccagatgaagactgccctggtctagcaatggcacgggcctttggagatttctgcctcaaagattatggccttatctccattcctgaagtttgctacaaaaacatcacaagcgatgatgaatttgtggtcttggcaactgatggggtaggaacaaaaactttgttacttcatgaccaggttacttg
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

62

Amino Acids

6.75

Weight (kDa)

4.11

Isoelectric Point (pI)

27.17

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 122
AcuI CTGAAG 1 cut(s) 108
AjnI CCWGG 2 cut(s) 19, 177
AoxI GGCC 2 cut(s) 39, 70
ApoI RAATTY 1 cut(s) 122
AspS9I GGNCC 1 cut(s) 39
BbsI GAAGAC 1 cut(s) 18
BccI CCATC 1 cut(s) 137
BciT130I CCWGG 2 cut(s) 21, 179
BfaI CTAG 1 cut(s) 26
Bme1390I CCNGG 2 cut(s) 21, 179
BmgT120I GGNCC 1 cut(s) 39
BmrFI CCNGG 2 cut(s) 21, 179
BpiI GAAGAC 1 cut(s) 18
BsaJI CCNNGG 1 cut(s) 19
Bse3DI GCAATG 1 cut(s) 36
BseBI CCWGG 2 cut(s) 21, 179
BseDI CCNNGG 1 cut(s) 19
BseMI GCAATG 1 cut(s) 36
BshFI GGCC 2 cut(s) 41, 72
BsnI GGCC 2 cut(s) 41, 72
BspANI GGCC 2 cut(s) 41, 72
BspHI TCATGA 1 cut(s) 172
BsrDI GCAATG 1 cut(s) 36
BssECI CCNNGG 1 cut(s) 19
Bst2UI CCWGG 2 cut(s) 21, 179
BstNI CCWGG 2 cut(s) 21, 179
BstSCI CCNGG 2 cut(s) 19, 177
BstV2I GAAGAC 1 cut(s) 18
BsuRI GGCC 2 cut(s) 41, 72
BtgZI GCGATG 1 cut(s) 129
CciI TCATGA 1 cut(s) 172
Cfr13I GGNCC 1 cut(s) 39
CsiI ACCWGGT 1 cut(s) 177
CviAII CATG 1 cut(s) 173
CviJI RGCY 2 cut(s) 41, 72
CviKI_1 RGCY 2 cut(s) 41, 72
Eco57I CTGAAG 1 cut(s) 108
EcoRII CCWGG 2 cut(s) 19, 177
FaeI CATG 1 cut(s) 176
FaiI YATR 2 cut(s) 69, 174
FatI CATG 1 cut(s) 172
FspBI CTAG 1 cut(s) 26
HaeIII GGCC 2 cut(s) 41, 72
Hin1II CATG 1 cut(s) 176
Hpy188III TCNNGA 2 cut(s) 86, 173
Hsp92II CATG 1 cut(s) 176
LpnPI CCDG 5 cut(s) 6, 18, 33, 99, 164
MabI ACCWGGT 1 cut(s) 177
MaeI CTAG 1 cut(s) 26
MaeIII GTNAC 2 cut(s) 165, 181
MboII GAAGA 1 cut(s) 23
MluCI AATT 1 cut(s) 122
MnlI CCTC 1 cut(s) 68
MspR9I CCNGG 2 cut(s) 21, 179
MvaI CCWGG 2 cut(s) 21, 179
NlaIII CATG 1 cut(s) 176
PagI TCATGA 1 cut(s) 172
Psp6I CCWGG 2 cut(s) 19, 177
PspGI CCWGG 2 cut(s) 19, 177
PspPI GGNCC 1 cut(s) 39
Sau96I GGNCC 1 cut(s) 39
ScrFI CCNGG 2 cut(s) 21, 179
SetI ASST 1 cut(s) 183
SexAI ACCWGGT 1 cut(s) 177
SgeI CNNG 9 cut(s) 17, 32, 33, 38, 48, 50, 98, 123, 145
Sse9I AATT 1 cut(s) 122
SspMI CTAG 1 cut(s) 26
StyD4I CCNGG 2 cut(s) 19, 177
TasI AATT 1 cut(s) 122
TspDTI ATGAA 3 cut(s) 24, 135, 161
XapI RAATTY 1 cut(s) 122
XspI CTAG 1 cut(s) 26
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.