Rmu_sc0014309.1_g000006

phosphatase 2C

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0014309.1
Physical Location & Seq
Reverse (-)
32977 .. 33638
662 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0014309.1_g000006.1.cds

Sequence Viewer

Length: 457 bp
agagcttagcctcgattcaaccatcgatagcttctgcagtggttcaacagctgtaaatgtagttaaacagggtgatcacttggtaattgcgaacttgggggattctcgtgcagttcttggcactaggggagaggataatcaaatcgttcctgtccaactcacagttgatttaaaaccggatactccaagtgaagcagatagaattaaaaagtgcaacggcagaatttttgcattggatgaagaaccggaagtgtacagattatggatgccagatgaagactgccctggtctagcaatggcacgggcctttggagatttctgcctcaaagattatggccttatctccattcctgaagtttgctacaaaaacatcacaagcgatgatgaatttgtggtcttggcaactgatggggtaggaacaaaaactttgttacttcatgaccaggttacttggtaa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

151

Amino Acids

16.55

Weight (kDa)

4.33

Isoelectric Point (pI)

26.15

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 2 cut(s) 223, 387
AcuI CTGAAG 1 cut(s) 373
AfaI GTAC 1 cut(s) 255
AgsI TTSAA 2 cut(s) 19, 46
AjnI CCWGG 2 cut(s) 284, 442
AluBI AGCT 3 cut(s) 5, 31, 51
AluI AGCT 3 cut(s) 5, 31, 51
AoxI GGCC 2 cut(s) 304, 335
ApoI RAATTY 2 cut(s) 223, 387
AspS9I GGNCC 1 cut(s) 304
AsuHPI GGTGA 1 cut(s) 84
BauI CACGAG 1 cut(s) 106
BbsI GAAGAC 1 cut(s) 283
BccI CCATC 2 cut(s) 30, 402
BceAI ACGGC 1 cut(s) 233
BciT130I CCWGG 2 cut(s) 286, 444
BciVI GTATCC 1 cut(s) 173
BclI TGATCA 1 cut(s) 74
BfaI CTAG 2 cut(s) 124, 291
BfmI CTRYAG 1 cut(s) 35
BfuI GTATCC 1 cut(s) 173
BlpI GCTNAGC 1 cut(s) 6
Bme1390I CCNGG 2 cut(s) 286, 444
BmgT120I GGNCC 1 cut(s) 304
BmrFI CCNGG 2 cut(s) 286, 444
BmsI GCATC 1 cut(s) 256
BpiI GAAGAC 1 cut(s) 283
Bpu1102I GCTNAGC 1 cut(s) 6
Bsa29I ATCGAT 1 cut(s) 25
BsaJI CCNNGG 1 cut(s) 284
BsaWI WCCGGW 2 cut(s) 176, 245
Bse3DI GCAATG 1 cut(s) 301
BseBI CCWGG 2 cut(s) 286, 444
BseCI ATCGAT 1 cut(s) 25
BseDI CCNNGG 1 cut(s) 284
BseGI GGATG 2 cut(s) 242, 271
BseMI GCAATG 1 cut(s) 301
BsgI GTGCAG 1 cut(s) 130
BshFI GGCC 2 cut(s) 306, 337
BshVI ATCGAT 1 cut(s) 25
BsiSI CCGG 2 cut(s) 177, 246
BsnI GGCC 2 cut(s) 306, 337
Bsp1407I TGTACA 1 cut(s) 253
Bsp143I GATC 1 cut(s) 74
Bsp1720I GCTNAGC 1 cut(s) 6
BspANI GGCC 2 cut(s) 306, 337
BspDI ATCGAT 1 cut(s) 25
BspHI TCATGA 1 cut(s) 437
BspMAI CTGCAG 1 cut(s) 39
BsrDI GCAATG 1 cut(s) 301
BsrGI TGTACA 1 cut(s) 253
BssECI CCNNGG 1 cut(s) 284
BssMI GATC 1 cut(s) 74
BssSI CACGAG 1 cut(s) 106
Bst2BI CACGAG 1 cut(s) 106
Bst2UI CCWGG 2 cut(s) 286, 444
Bst4CI ACNGT 1 cut(s) 164
BstAUI TGTACA 1 cut(s) 253
BstDEI CTNAG 1 cut(s) 6
BstF5I GGATG 2 cut(s) 242, 271
BstKTI GATC 1 cut(s) 77
BstMBI GATC 1 cut(s) 74
BstNI CCWGG 2 cut(s) 286, 444
BstSCI CCNGG 2 cut(s) 284, 442
BstSFI CTRYAG 1 cut(s) 35
BstV2I GAAGAC 1 cut(s) 283
Bsu15I ATCGAT 1 cut(s) 25
BsuI GTATCC 1 cut(s) 173
BsuRI GGCC 2 cut(s) 306, 337
BsuTUI ATCGAT 1 cut(s) 25
BtgZI GCGATG 1 cut(s) 394
BtsCI GGATG 2 cut(s) 242, 271
BtsI GCAGTG 1 cut(s) 44
BtsIMutI CAGTG 1 cut(s) 44
CciI TCATGA 1 cut(s) 437
Cfr13I GGNCC 1 cut(s) 304
ClaI ATCGAT 1 cut(s) 25
CsiI ACCWGGT 1 cut(s) 442
Csp6I GTAC 1 cut(s) 254
CviAII CATG 1 cut(s) 438
CviJI RGCY 6 cut(s) 5, 10, 31, 51, 306, 337
CviKI_1 RGCY 6 cut(s) 5, 10, 31, 51, 306, 337
CviQI GTAC 1 cut(s) 254
DdeI CTNAG 1 cut(s) 6
DpnI GATC 1 cut(s) 76
DpnII GATC 1 cut(s) 74
DraI TTTAAA 1 cut(s) 172
Eco57I CTGAAG 1 cut(s) 373
EcoRII CCWGG 2 cut(s) 284, 442
FaeI CATG 1 cut(s) 441
FaiI YATR 3 cut(s) 263, 334, 439
FatI CATG 1 cut(s) 437
FbaI TGATCA 1 cut(s) 74
FokI GGATG 2 cut(s) 249, 278
FspBI CTAG 2 cut(s) 124, 291
HaeIII GGCC 2 cut(s) 306, 337
HapII CCGG 2 cut(s) 177, 246
Hin1II CATG 1 cut(s) 441
HinfI GANTC 2 cut(s) 15, 102
HpaII CCGG 2 cut(s) 177, 246
HphI GGTGA 1 cut(s) 84
Hpy166II GTNNAC 1 cut(s) 254
Hpy188III TCNNGA 2 cut(s) 351, 438
Hpy8I GTNNAC 1 cut(s) 254
HpyCH4III ACNGT 1 cut(s) 164
HpyCH4V TGCA 4 cut(s) 37, 111, 214, 231
HpyF3I CTNAG 1 cut(s) 6
Hsp92II CATG 1 cut(s) 441
Ksp22I TGATCA 1 cut(s) 74
Kzo9I GATC 1 cut(s) 74
LpnPI CCDG 9 cut(s) 54, 163, 190, 259, 271, 283, 298, 364, 429
LweI GCATC 1 cut(s) 256
MabI ACCWGGT 1 cut(s) 442
MaeI CTAG 2 cut(s) 124, 291
MaeIII GTNAC 2 cut(s) 430, 446
MalI GATC 1 cut(s) 76
MboI GATC 1 cut(s) 74
MboII GAAGA 2 cut(s) 252, 288
MluCI AATT 4 cut(s) 85, 202, 223, 387
MmeI TCCRAC 1 cut(s) 179
MnlI CCTC 3 cut(s) 21, 125, 333
MseI TTAA 3 cut(s) 64, 171, 205
MspA1I CMGCKG 1 cut(s) 51
MspI CCGG 2 cut(s) 177, 246
MspR9I CCNGG 2 cut(s) 286, 444
MvaI CCWGG 2 cut(s) 286, 444
NdeII GATC 1 cut(s) 74
NlaIII CATG 1 cut(s) 441
PagI TCATGA 1 cut(s) 437
PfeI GAWTC 2 cut(s) 15, 102
Psp6I CCWGG 2 cut(s) 284, 442
PspGI CCWGG 2 cut(s) 284, 442
PspPI GGNCC 1 cut(s) 304
PstI CTGCAG 1 cut(s) 39
PvuII CAGCTG 1 cut(s) 51
RsaI GTAC 1 cut(s) 255
RsaNI GTAC 1 cut(s) 254
SaqAI TTAA 3 cut(s) 64, 171, 205
Sau3AI GATC 1 cut(s) 74
Sau96I GGNCC 1 cut(s) 304
ScrFI CCNGG 2 cut(s) 286, 444
SetI ASST 4 cut(s) 7, 33, 53, 448
SexAI ACCWGGT 1 cut(s) 442
SfaNI GCATC 1 cut(s) 256
SfcI CTRYAG 1 cut(s) 35
Sse9I AATT 4 cut(s) 85, 202, 223, 387
SspMI CTAG 2 cut(s) 124, 291
StyD4I CCNGG 2 cut(s) 284, 442
TaaI ACNGT 1 cut(s) 164
TaqI TCGA 2 cut(s) 13, 25
TasI AATT 4 cut(s) 85, 202, 223, 387
TatI WGTACW 1 cut(s) 253
TfiI GAWTC 2 cut(s) 15, 102
Tru1I TTAA 3 cut(s) 64, 171, 205
Tru9I TTAA 3 cut(s) 64, 171, 205
TscAI CASTG 1 cut(s) 44
TspDTI ATGAA 4 cut(s) 253, 289, 400, 426
TspRI CASTG 1 cut(s) 44
XapI RAATTY 2 cut(s) 223, 387
XspI CTAG 2 cut(s) 124, 291
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.