Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_co8098660.1

Orthogroup ID

OG0006659

Physical Location & Seq

Genomic Coordinates Reverse (-)

1 .. 551

Gene Structure 551 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_co8098660.1_g000001.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 429 bp

atgcattgcctatcatataaaccccaagtgagatttccgacttttggaatcatactatgctcatcttctgaggttagtgtgtcaaggcagcaagttttgaagcaagtggataaggagttggctaaaggagatgagagggcagctctttcacttgttaaagatttgcagggcaagccaggtggcctcagatgctttggtgctgctaggcaggtgcctcaaaggctttacactttggatgagctgaagctgaatggaatagtagcacagtctcttctgtcaccagtggatgctactcttggttccatagaaagaaatcttcagattgctgctgtggttggaggtgtttctgcatggaatgttttcgggtttagtcctcagcagcttttctatgcttctttagcagcattgtttctgtggactctggacgcg

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

No domains found.

Protein Analysis

143

Amino Acids

15.54

Weight (kDa)

8.88

Isoelectric Point (pI)

50.55

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0006659)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT5G27290 AT5G27290
fragaria_vesca	FvH4_6g04940 FvH4_6g04940 FvH4_6g04940 FvH4_6g04940 FvH4_6g04940
malus_domestica	MD04G1212700.v1.1
prunus_persica	Prupe.6G333000_v2.0.a1 Prupe.6G333000_v2.0.a1 Prupe.6G333000_v2.0.a1
pyrus_communis	pycom04g18870
rosa_chinensis	RchiOBHm_Chr3g0453431
rosa_laevigata	RLG00000025515
rosa_multiflora	Rmu_co8098660.1_g000001 Rmu_sc0000510.1_g000005 Rmu_sc0037544.1_g000001
rosa_roxburghii	Rroxscaffold_6G00430400
rosa_rugosa	Rorug02G0648800 Rorug02G0648900 Rorug02G0649000
rosa_samantha	Rh3AG051800 Rh3BG053200 Rh3CG052500 Rh3DG053300
rosa_wichuraiana	Rw3G003980

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AarI	CACCTGC	1 cut(s)	199
Acc36I	ACCTGC	1 cut(s)	199
AccB1I	GGYRCC	1 cut(s)	211
AccII	CGCG	1 cut(s)	428
AcuI	CTGAAG	2 cut(s)	263, 302
AfiI	CCNNNNNNNGG	1 cut(s)	44
AgsI	TTSAA	1 cut(s)	100
AjnI	CCWGG	1 cut(s)	175
AjuI	GAANNNNNNNTTGG	2 cut(s)	18, 50
AluBI	AGCT	4 cut(s)	143, 241, 247, 382
AluI	AGCT	4 cut(s)	143, 241, 247, 382
Alw26I	GTCTC	1 cut(s)	273
AoxI	GGCC	1 cut(s)	181
ApeKI	GCWGC	6 cut(s)	88, 140, 200, 326, 379, 401
Asp700I	GAANNNNTTC	1 cut(s)	359
AsuHPI	GGTGA	1 cut(s)	270
BanI	GGYRCC	1 cut(s)	211
BbvCI	CCTCAGC	1 cut(s)	375
BbvI	GCAGC	6 cut(s)	100, 152, 187, 313, 391, 413
BciT130I	CCWGG	1 cut(s)	177
BcoDI	GTCTC	1 cut(s)	273
BfaI	CTAG	1 cut(s)	204
BfuAI	ACCTGC	1 cut(s)	199
BglI	GCCNNNNNGGC	1 cut(s)	220
BisI	GCNGC	6 cut(s)	89, 141, 201, 327, 380, 402
BlsI	GCNGC	6 cut(s)	90, 142, 202, 328, 381, 403
Bme1390I	CCNGG	1 cut(s)	177
BmiI	GGNNCC	2 cut(s)	213, 301
BmrFI	CCNGG	1 cut(s)	177
BmsI	GCATC	2 cut(s)	179, 277
BplI	GAGNNNNNCTC	2 cut(s)	127, 159
Bpu10I	CCTNAGC	1 cut(s)	375
Bsc4I	CCNNNNNNNGG	1 cut(s)	44
Bse1I	ACTGG	1 cut(s)	281
Bse3DI	GCAATG	1 cut(s)	4
BseBI	CCWGG	1 cut(s)	177
BseGI	GGATG	2 cut(s)	241, 292
BseLI	CCNNNNNNNGG	1 cut(s)	44
BseMI	GCAATG	1 cut(s)	4
BseMII	CTCAG	3 cut(s)	60, 199, 389
BseNI	ACTGG	1 cut(s)	281
BseXI	GCAGC	6 cut(s)	100, 152, 187, 313, 391, 413
Bsh1236I	CGCG	1 cut(s)	428
BshFI	GGCC	1 cut(s)	183
BshNI	GGYRCC	1 cut(s)	211
BslI	CCNNNNNNNGG	1 cut(s)	44
BsmAI	GTCTC	1 cut(s)	273
BsnI	GGCC	1 cut(s)	183
BspANI	GGCC	1 cut(s)	183
BspCNI	CTCAG	3 cut(s)	61, 198, 388
BspFNI	CGCG	1 cut(s)	428
BspLI	GGNNCC	2 cut(s)	213, 301
BspMI	ACCTGC	1 cut(s)	199
BspT107I	GGYRCC	1 cut(s)	211
BsrDI	GCAATG	1 cut(s)	4
BsrI	ACTGG	1 cut(s)	281
Bst2UI	CCWGG	1 cut(s)	177
Bst4CI	ACNGT	1 cut(s)	267
Bst6I	CTCTTC	1 cut(s)	276
BstC8I	GCNNGC	1 cut(s)	173
BstDEI	CTNAG	3 cut(s)	69, 185, 375
BstF5I	GGATG	2 cut(s)	241, 292
BstFNI	CGCG	1 cut(s)	428
BstMAI	GTCTC	1 cut(s)	273
BstMWI	GCNNNNNNNGC	4 cut(s)	172, 189, 220, 398
BstNI	CCWGG	1 cut(s)	177
BstSCI	CCNGG	1 cut(s)	175
BstUI	CGCG	1 cut(s)	428
BstV1I	GCAGC	6 cut(s)	100, 152, 187, 313, 391, 413
BsuRI	GGCC	1 cut(s)	183
BtsCI	GGATG	2 cut(s)	241, 292
BtsIMutI	CAGTG	1 cut(s)	288
BveI	ACCTGC	1 cut(s)	199
Cac8I	GCNNGC	1 cut(s)	173
CspCI	CAANNNNNGTGG	2 cut(s)	160, 195
CviAII	CATG	1 cut(s)	351
CviJI	RGCY	8 cut(s)	122, 143, 175, 183, 223, 241, 247, 382
CviKI_1	RGCY	8 cut(s)	122, 143, 175, 183, 223, 241, 247, 382
DdeI	CTNAG	3 cut(s)	69, 185, 375
Eam1104I	CTCTTC	1 cut(s)	276
EarI	CTCTTC	1 cut(s)	276
Eco57I	CTGAAG	2 cut(s)	263, 302
EcoRII	CCWGG	1 cut(s)	175
EcoT22I	ATGCAT	1 cut(s)	6
FaeI	CATG	1 cut(s)	354
FaiI	YATR	7 cut(s)	16, 18, 53, 58, 305, 352, 390
FatI	CATG	1 cut(s)	350
Fnu4HI	GCNGC	6 cut(s)	89, 141, 201, 327, 380, 402
FokI	GGATG	2 cut(s)	248, 299
Fsp4HI	GCNGC	6 cut(s)	89, 141, 201, 327, 380, 402
FspBI	CTAG	1 cut(s)	204
GluI	GCNGC	6 cut(s)	89, 141, 201, 327, 380, 402
HaeIII	GGCC	1 cut(s)	183
Hin1II	CATG	1 cut(s)	354
HinfI	GANTC	2 cut(s)	48, 418
HphI	GGTGA	1 cut(s)	270
Hpy166II	GTNNAC	1 cut(s)	417
Hpy188I	TCNGA	4 cut(s)	39, 70, 188, 321
Hpy188III	TCNNGA	1 cut(s)	422
Hpy8I	GTNNAC	1 cut(s)	417
HpyCH4III	ACNGT	1 cut(s)	267
HpyCH4V	TGCA	3 cut(s)	4, 166, 350
HpyF10VI	GCNNNNNNNGC	4 cut(s)	172, 189, 220, 398
HpyF3I	CTNAG	3 cut(s)	69, 185, 375
Hsp92II	CATG	1 cut(s)	354
LpnPI	CCDG	6 cut(s)	152, 162, 189, 194, 294, 407
Lsp1109I	GCAGC	6 cut(s)	100, 152, 187, 313, 391, 413
LweI	GCATC	2 cut(s)	179, 277
MaeI	CTAG	1 cut(s)	204
MaeIII	GTNAC	1 cut(s)	276
MboII	GAAGA	3 cut(s)	57, 263, 308
MlyI	GAGTC	1 cut(s)	412
MmeI	TCCRAC	2 cut(s)	62, 316
MnlI	CCTC	6 cut(s)	64, 129, 194, 225, 332, 384
Mph1103I	ATGCAT	1 cut(s)	6
MroXI	GAANNNNTTC	1 cut(s)	359
MseI	TTAA	1 cut(s)	156
MspR9I	CCNGG	1 cut(s)	177
MvaI	CCWGG	1 cut(s)	177
MvnI	CGCG	1 cut(s)	428
MwoI	GCNNNNNNNGC	4 cut(s)	172, 189, 220, 398
NlaIII	CATG	1 cut(s)	354
NlaIV	GGNNCC	2 cut(s)	213, 301
NmuCI	GTSAC	1 cut(s)	276
NsiI	ATGCAT	1 cut(s)	6
PaqCI	CACCTGC	1 cut(s)	199
PdmI	GAANNNNTTC	1 cut(s)	359
PfeI	GAWTC	1 cut(s)	48
PkrI	GCNGC	6 cut(s)	90, 142, 202, 328, 381, 403
PleI	GAGTC	1 cut(s)	412
PpsI	GAGTC	1 cut(s)	412
Psp6I	CCWGG	1 cut(s)	175
PspGI	CCWGG	1 cut(s)	175
PspN4I	GGNNCC	2 cut(s)	213, 301
SaqAI	TTAA	1 cut(s)	156
SatI	GCNGC	6 cut(s)	89, 141, 201, 327, 380, 402
SchI	GAGTC	1 cut(s)	412
ScrFI	CCNGG	1 cut(s)	177
SetI	ASST	8 cut(s)	75, 145, 181, 213, 243, 249, 343, 384
SfaNI	GCATC	2 cut(s)	179, 277
SspMI	CTAG	1 cut(s)	204
StyD4I	CCNGG	1 cut(s)	175
TaaI	ACNGT	1 cut(s)	267
TfiI	GAWTC	1 cut(s)	48
Tru1I	TTAA	1 cut(s)	156
Tru9I	TTAA	1 cut(s)	156
TscAI	CASTG	1 cut(s)	288
TseFI	GTSAC	1 cut(s)	276
TseI	GCWGC	6 cut(s)	88, 140, 200, 326, 379, 401
Tsp45I	GTSAC	1 cut(s)	276
TspRI	CASTG	1 cut(s)	288
XmnI	GAANNNNTTC	1 cut(s)	359
XspI	CTAG	1 cut(s)	204
Zsp2I	ATGCAT	1 cut(s)	6

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.