Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_co8110220.1

Orthogroup ID

OG0010551

Physical Location & Seq

Genomic Coordinates Reverse (-)

2 .. 598

Gene Structure 597 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_co8110220.1_g000001.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 373 bp

atgctgttacttttgcagaacctgaaaggcagggcatctgaagattcaaggacagcaccaggtgcgcacaggcgaatggtcaggggtggtggccaagggaattattcttctgatgctggtggtgggaggaattcttctgcacggagggaaaatggagccagtcatgttgcagatggaggttctctgtcctcttttatgccaggtcagcagaaaactaagaacattgctgcggctccaatcgcaaaagcttcaattggcattccaaacgggattaaaaacctgtcaaatgggacttctagtcatgtttctgctccaaaatcctctgccggtgtagatgcaaacaagttgggagctacagcacctcgttatgctg

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0003674 GO:0005488 GO:0005515 GO:0005575 GO:0005622 GO:0005623 GO:0005634 GO:0008150 GO:0042802 GO:0043226 GO:0043227 GO:0043229 GO:0043231 GO:0043388 GO:0044093 GO:0044424 GO:0044464 GO:0051082 GO:0051098 GO:0051099 GO:0051101 GO:0065007 GO:0065009

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

DUF1296

Protein Analysis

124

Amino Acids

12.5

Weight (kDa)

11.0

Isoelectric Point (pI)

44.53

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0010551)

Species	Orthologous Gene IDs
fragaria_vesca	FvH4_3g42501
malus_domestica	MD03G1031400.v1.1 MD11G1035700.v1.1
prunus_persica	Prupe.6G026700_v2.0.a1 Prupe.6G026700_v2.0.a1
pyrus_communis	pycom03g02550 pycom11g02960
rosa_chinensis	RchiOBHm_Chr5g0076171 RchiOBHm_Chr5g0076181
rosa_laevigata	RLG00000036607
rosa_multiflora	Rmu_co8110220.1_g000001 Rmu_sc0003601.1_g000003 Rmu_sc0037654.1_g000001 Rmu_ssc0000123.1_g000003
rosa_roxburghii	Rroxscaffold_1G00005640
rosa_rugosa	Rorug05G0445300
rosa_samantha	Rh5AG501400 Rh5BG522900 Rh5CG546700 Rh5DG535300
rosa_wichuraiana	Rw5G046540

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
Acc16I	TGCGCA	1 cut(s)	66
AciI	CCGC	1 cut(s)	230
AcoI	YGGCCR	1 cut(s)	91
AcsI	RAATTY	1 cut(s)	130
AcuI	CTGAAG	1 cut(s)	60
AdeI	CACNNNGTG	1 cut(s)	62
AgsI	TTSAA	2 cut(s)	48, 252
AhdI	GACNNNNNGTC	1 cut(s)	297
AjnI	CCWGG	2 cut(s)	58, 199
AluBI	AGCT	2 cut(s)	248, 353
AluI	AGCT	2 cut(s)	248, 353
AlwNI	CAGNNNCTG	1 cut(s)	22
AoxI	GGCC	1 cut(s)	91
ApeKI	GCWGC	1 cut(s)	227
ApoI	RAATTY	1 cut(s)	130
AspLEI	GCGC	1 cut(s)	67
BalI	TGGCCA	1 cut(s)	93
BbvI	GCAGC	1 cut(s)	214
BccI	CCATC	1 cut(s)	167
BciT130I	CCWGG	2 cut(s)	60, 201
BfaI	CTAG	1 cut(s)	297
BfmI	CTRYAG	1 cut(s)	354
BisI	GCNGC	2 cut(s)	228, 231
BlsI	GCNGC	2 cut(s)	229, 232
Bme1390I	CCNGG	2 cut(s)	60, 201
BmeRI	GACNNNNNGTC	1 cut(s)	297
BmiI	GGNNCC	2 cut(s)	157, 234
BmrFI	CCNGG	2 cut(s)	60, 201
BmsI	GCATC	3 cut(s)	44, 103, 325
BsaJI	CCNNGG	1 cut(s)	94
Bse118I	RCCGGY	1 cut(s)	326
Bse1I	ACTGG	1 cut(s)	159
Bse3DI	GCAATG	1 cut(s)	222
BseBI	CCWGG	2 cut(s)	60, 201
BseDI	CCNNGG	1 cut(s)	94
BseMI	GCAATG	1 cut(s)	222
BseNI	ACTGG	1 cut(s)	159
BseXI	GCAGC	1 cut(s)	214
BsgI	GTGCAG	1 cut(s)	123
BshFI	GGCC	1 cut(s)	93
BsiSI	CCGG	1 cut(s)	327
BslFI	GGGAC	1 cut(s)	304
BsmFI	GGGAC	1 cut(s)	304
BsmI	GAATGC	1 cut(s)	258
BsnI	GGCC	1 cut(s)	93
BspACI	CCGC	1 cut(s)	230
BspANI	GGCC	1 cut(s)	93
BspLI	GGNNCC	2 cut(s)	157, 234
BsrDI	GCAATG	1 cut(s)	222
BsrFI	RCCGGY	1 cut(s)	326
BsrI	ACTGG	1 cut(s)	159
BssAI	RCCGGY	1 cut(s)	326
BssECI	CCNNGG	1 cut(s)	94
BssT1I	CCWWGG	1 cut(s)	94
Bst2UI	CCWGG	2 cut(s)	60, 201
BstAPI	GCANNNNNTGC	1 cut(s)	62
BstDEI	CTNAG	1 cut(s)	216
BstHHI	GCGC	1 cut(s)	67
BstMWI	GCNNNNNNNGC	3 cut(s)	62, 205, 239
BstNI	CCWGG	2 cut(s)	60, 201
BstSCI	CCNGG	2 cut(s)	58, 199
BstSFI	CTRYAG	1 cut(s)	354
BstV1I	GCAGC	1 cut(s)	214
BsuRI	GGCC	1 cut(s)	93
CaiI	CAGNNNCTG	1 cut(s)	22
CfoI	GCGC	1 cut(s)	67
Cfr10I	RCCGGY	1 cut(s)	326
CsiI	ACCWGGT	1 cut(s)	58
CviAII	CATG	2 cut(s)	164, 302
CviJI	RGCY	5 cut(s)	93, 158, 233, 248, 353
CviKI_1	RGCY	5 cut(s)	93, 158, 233, 248, 353
DdeI	CTNAG	1 cut(s)	216
DraIII	CACNNNGTG	1 cut(s)	62
DriI	GACNNNNNGTC	1 cut(s)	297
EaeI	YGGCCR	1 cut(s)	91
Eam1105I	GACNNNNNGTC	1 cut(s)	297
Eco130I	CCWWGG	1 cut(s)	94
Eco57I	CTGAAG	1 cut(s)	60
EcoRI	GAATTC	1 cut(s)	130
EcoRII	CCWGG	2 cut(s)	58, 199
EcoT14I	CCWWGG	1 cut(s)	94
ErhI	CCWWGG	1 cut(s)	94
FaeI	CATG	2 cut(s)	167, 305
FaiI	YATR	4 cut(s)	165, 197, 303, 369
FaqI	GGGAC	1 cut(s)	304
FatI	CATG	2 cut(s)	163, 301
Fnu4HI	GCNGC	2 cut(s)	228, 231
Fsp4HI	GCNGC	2 cut(s)	228, 231
FspAI	RTGCGCAY	1 cut(s)	66
FspBI	CTAG	1 cut(s)	297
FspI	TGCGCA	1 cut(s)	66
GlaI	GCGC	1 cut(s)	66
GluI	GCNGC	2 cut(s)	228, 231
HaeIII	GGCC	1 cut(s)	93
HapII	CCGG	1 cut(s)	327
HhaI	GCGC	1 cut(s)	67
Hin1II	CATG	2 cut(s)	167, 305
Hin6I	GCGC	1 cut(s)	65
HinP1I	GCGC	1 cut(s)	65
HindIII	AAGCTT	1 cut(s)	246
HinfI	GANTC	1 cut(s)	44
HpaII	CCGG	1 cut(s)	327
Hpy188I	TCNGA	2 cut(s)	40, 112
HpyCH4V	TGCA	4 cut(s)	16, 140, 170, 338
HpyF10VI	GCNNNNNNNGC	3 cut(s)	62, 205, 239
HpyF3I	CTNAG	1 cut(s)	216
Hsp92II	CATG	2 cut(s)	167, 305
HspAI	GCGC	1 cut(s)	65
LmnI	GCTCC	4 cut(s)	155, 238, 316, 350
Lsp1109I	GCAGC	1 cut(s)	214
LweI	GCATC	3 cut(s)	44, 103, 325
MabI	ACCWGGT	1 cut(s)	58
MaeI	CTAG	1 cut(s)	297
MaeIII	GTNAC	1 cut(s)	6
MboII	GAAGA	3 cut(s)	53, 99, 126
MfeI	CAATTG	1 cut(s)	252
MlsI	TGGCCA	1 cut(s)	93
MluCI	AATT	3 cut(s)	100, 130, 252
MluNI	TGGCCA	1 cut(s)	93
MnlI	CCTC	6 cut(s)	120, 138, 170, 199, 331, 372
Mox20I	TGGCCA	1 cut(s)	93
MscI	TGGCCA	1 cut(s)	93
MseI	TTAA	1 cut(s)	273
Msp20I	TGGCCA	1 cut(s)	93
MspI	CCGG	1 cut(s)	327
MspR9I	CCNGG	2 cut(s)	60, 201
MunI	CAATTG	1 cut(s)	252
Mva1269I	GAATGC	1 cut(s)	258
MvaI	CCWGG	2 cut(s)	60, 201
MwoI	GCNNNNNNNGC	3 cut(s)	62, 205, 239
NlaIII	CATG	2 cut(s)	167, 305
NlaIV	GGNNCC	2 cut(s)	157, 234
NsbI	TGCGCA	1 cut(s)	66
PctI	GAATGC	1 cut(s)	258
PfeI	GAWTC	1 cut(s)	44
PkrI	GCNGC	2 cut(s)	229, 232
Psp6I	CCWGG	2 cut(s)	58, 199
PspGI	CCWGG	2 cut(s)	58, 199
PspN4I	GGNNCC	2 cut(s)	157, 234
PstNI	CAGNNNCTG	1 cut(s)	22
SaqAI	TTAA	1 cut(s)	273
SatI	GCNGC	2 cut(s)	228, 231
ScrFI	CCNGG	2 cut(s)	60, 201
SetI	ASST	8 cut(s)	24, 64, 181, 205, 250, 282, 355, 364
SexAI	ACCWGGT	1 cut(s)	58
SfaNI	GCATC	3 cut(s)	44, 103, 325
SfcI	CTRYAG	1 cut(s)	354
Sse9I	AATT	3 cut(s)	100, 130, 252
SsiI	CCGC	1 cut(s)	230
SspMI	CTAG	1 cut(s)	297
StyD4I	CCNGG	2 cut(s)	58, 199
StyI	CCWWGG	1 cut(s)	94
TasI	AATT	3 cut(s)	100, 130, 252
TauI	GCSGC	1 cut(s)	233
TfiI	GAWTC	1 cut(s)	44
Tru1I	TTAA	1 cut(s)	273
Tru9I	TTAA	1 cut(s)	273
TseI	GCWGC	1 cut(s)	227
TspGWI	ACGGA	1 cut(s)	157
XapI	RAATTY	1 cut(s)	130
XspI	CTAG	1 cut(s)	297

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.