Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_co8113988.1

Orthogroup ID

OG0005342

Physical Location & Seq

Genomic Coordinates Forward (+)

121 .. 525

Gene Structure 405 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_co8113988.1_g000001.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 405 bp

atgggtaaaagaaaagttaaatttgaaaattcaaagagagatgcagataactctgaacaaagaggaggtgatgggcttcgtcctattaaaatgcaagagtcgaaaagagctaagaaaatttccgagggtgatagaagccagacaaatcaggtttcagctcccacaaatcaaatgaaggatgcaagtgatggaggtagagcttcaaatcaagctggaacttctcaagatttaattgcaaaaaggaaacaacagcgtgaagctgttgatgctattctttactcggctctgattccttcaaagagttccaaatctgaaacatcaatgagacctgtgcctgccaaaagacctctatcttcctcaactgcaggtggtggcataaaaccagcaaagacaaggaaagattaa

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

AAA_11 AAA_12 SEN1_N

Protein Analysis

134

Amino Acids

14.49

Weight (kDa)

10.38

Isoelectric Point (pI)

53.75

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0005342)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT1G16800 AT1G16800 AT1G16800
fragaria_vesca	FvH4_6g36870 FvH4_6g36870 FvH4_6g36870 FvH4_6g36870 FvH4_6g36870 FvH4_6g36870 FvH4_6g36870
malus_domestica	MD17G1161500.v1.1
prunus_persica	Prupe.3G023800_v2.0.a1 Prupe.3G023800_v2.0.a1 Prupe.3G023800_v2.0.a1 Prupe.3G023800_v2.0.a1 Prupe.3G023800_v2.0.a1
pyrus_communis	pycom17g15460
rosa_chinensis	RchiOBHm_Chr2g0149261
rosa_laevigata	RLG00000020388
rosa_multiflora	Rmu_co8056652.1_g000001 Rmu_co8113988.1_g000001 Rmu_sc0001615.1_g000015
rosa_roxburghii	Rroxscaffold_2G00098260
rosa_rugosa	Rorug02G0410000
rosa_samantha	Rh2AG470900 Rh2BG483100 Rh2CG456800 Rh2DG492100
rosa_wichuraiana	Rw2G038300

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AarI	CACCTGC	1 cut(s)	356
Acc36I	ACCTGC	1 cut(s)	356
AcsI	RAATTY	3 cut(s)	20, 28, 117
AgsI	TTSAA	4 cut(s)	26, 33, 204, 297
AluBI	AGCT	5 cut(s)	110, 158, 200, 212, 260
AluI	AGCT	5 cut(s)	110, 158, 200, 212, 260
Alw26I	GTCTC	1 cut(s)	319
ApoI	RAATTY	3 cut(s)	20, 28, 117
AsuHPI	GGTGA	2 cut(s)	80, 140
BccI	CCATC	2 cut(s)	65, 182
BcoDI	GTCTC	1 cut(s)	319
BfmI	CTRYAG	1 cut(s)	363
BfuAI	ACCTGC	1 cut(s)	356
BmsI	GCATC	3 cut(s)	31, 169, 256
BpuEI	CTTGAG	1 cut(s)	207
BsaI	GGTCTC	1 cut(s)	319
BsaJI	CCNNGG	1 cut(s)	123
BseDI	CCNNGG	1 cut(s)	123
BseGI	GGATG	1 cut(s)	184
BseRI	GAGGAG	1 cut(s)	78
BsmAI	GTCTC	1 cut(s)	319
Bso31I	GGTCTC	1 cut(s)	319
BspMAI	CTGCAG	1 cut(s)	367
BspMI	ACCTGC	1 cut(s)	356
BspTNI	GGTCTC	1 cut(s)	319
BssECI	CCNNGG	1 cut(s)	123
BstC8I	GCNNGC	1 cut(s)	336
BstDEI	CTNAG	1 cut(s)	111
BstF5I	GGATG	1 cut(s)	184
BstMAI	GTCTC	1 cut(s)	319
BstMWI	GCNNNNNNNGC	1 cut(s)	266
BstSFI	CTRYAG	1 cut(s)	363
BtsCI	GGATG	1 cut(s)	184
BveI	ACCTGC	1 cut(s)	356
Cac8I	GCNNGC	1 cut(s)	336
CviJI	RGCY	8 cut(s)	76, 110, 138, 158, 200, 212, 260, 284
CviKI_1	RGCY	8 cut(s)	76, 110, 138, 158, 200, 212, 260, 284
DdeI	CTNAG	1 cut(s)	111
Eco31I	GGTCTC	1 cut(s)	319
FaiI	YATR	1 cut(s)	377
FokI	GGATG	1 cut(s)	191
HinfI	GANTC	2 cut(s)	98, 289
HphI	GGTGA	2 cut(s)	80, 140
Hpy188I	TCNGA	4 cut(s)	55, 124, 288, 313
Hpy188III	TCNNGA	1 cut(s)	224
HpyAV	CCTTC	2 cut(s)	169, 303
HpyCH4V	TGCA	5 cut(s)	44, 94, 182, 236, 365
HpyF10VI	GCNNNNNNNGC	1 cut(s)	266
HpyF3I	CTNAG	1 cut(s)	111
LmnI	GCTCC	1 cut(s)	163
LpnPI	CCDG	7 cut(s)	134, 152, 198, 342, 348, 351, 396
LweI	GCATC	3 cut(s)	31, 169, 256
MboII	GAAGA	1 cut(s)	345
MluCI	AATT	4 cut(s)	20, 28, 117, 231
MlyI	GAGTC	1 cut(s)	107
MnlI	CCTC	6 cut(s)	56, 59, 118, 185, 357, 367
MseI	TTAA	4 cut(s)	18, 87, 230, 403
MwoI	GCNNNNNNNGC	1 cut(s)	266
NmeAIII	GCCGAG	1 cut(s)	260
PaqCI	CACCTGC	1 cut(s)	356
PfeI	GAWTC	1 cut(s)	289
PleI	GAGTC	1 cut(s)	106
PpsI	GAGTC	1 cut(s)	106
PstI	CTGCAG	1 cut(s)	367
SaqAI	TTAA	4 cut(s)	18, 87, 230, 403
SchI	GAGTC	1 cut(s)	107
SfaNI	GCATC	3 cut(s)	31, 169, 256
SfcI	CTRYAG	1 cut(s)	363
SmlI	CTYRAG	1 cut(s)	222
SmoI	CTYRAG	1 cut(s)	222
Sse9I	AATT	4 cut(s)	20, 28, 117, 231
TaqI	TCGA	1 cut(s)	101
TasI	AATT	4 cut(s)	20, 28, 117, 231
TfiI	GAWTC	1 cut(s)	289
Tru1I	TTAA	4 cut(s)	18, 87, 230, 403
Tru9I	TTAA	4 cut(s)	18, 87, 230, 403
TspDTI	ATGAA	1 cut(s)	188
XapI	RAATTY	3 cut(s)	20, 28, 117

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.