Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_co8121856.1

Orthogroup ID

OG0008978

Physical Location & Seq

Genomic Coordinates Forward (+)

1 .. 621

Gene Structure 621 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_co8121856.1_g000001.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 322 bp

cgaagggaaggactgtgcttgaggttggagctgatggggtggcgctcatcaccatcatcaaccctcctgtcaattccctctcctttgatgtgttatttggcttgaaagagagctatgaggaggctctgaggagagaagatgttaaggcaattgtcgttacaggtgcaagagggaaattctctggcggatttgatattactgcttttggtggacttcaaggaggccagaaagcggagccgaagcctggttatatatctgtggaggttatcactaacagtgtagaaggtgctaggaaaccttcagttgctgccattgatggcct

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0003674 GO:0003824 GO:0004165 GO:0004300 GO:0005575 GO:0005622 GO:0005623 GO:0005737 GO:0005777 GO:0006082 GO:0006629 GO:0006631 GO:0006635 GO:0008150 GO:0008152 GO:0008692 GO:0009056 GO:0009062 GO:0009514 GO:0009987 GO:0016042 GO:0016054 GO:0016829 GO:0016835 GO:0016836 GO:0016853 GO:0016854 GO:0016856 GO:0016860 GO:0016863 GO:0018812 GO:0019395 GO:0019752 GO:0030258 GO:0032787 GO:0034440 GO:0042579 GO:0043226 GO:0043227 GO:0043229 GO:0043231 GO:0043436 GO:0044237 GO:0044238 GO:0044242 GO:0044248 GO:0044255 GO:0044281 GO:0044282 GO:0044424 GO:0044444 GO:0044464 GO:0046395 GO:0055114 GO:0071704 GO:0072329 GO:1901575

KEGG Pathways

Metabolic & Signaling

ko00071 ko00592 ko01100 ko01110 ko01212 map00071 map00592 map01100 map01110 map01212

Pfam Domains

Protein Families

3HCDH 3HCDH_N ECH_1

Protein Analysis

107

Amino Acids

11.13

Weight (kDa)

5.41

Isoelectric Point (pI)

25.35

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0008978)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT3G06860
fragaria_vesca	FvH4_4g18500 FvH4_4g18500 FvH4_4g18500
malus_domestica	MD13G1166700.v1.1 MD16G1166400.v1.1
prunus_persica	Prupe.1G133000_v2.0.a1
pyrus_communis	pycom13g14220 pycom16g14060
rosa_chinensis	RchiOBHm_Chr4g0423051
rosa_laevigata	RLG00000007590
rosa_multiflora	Rmu_co8121856.1_g000001 Rmu_sc0006639.1_g000001 Rmu_sc0023965.1_g000001 Rmu_sc0028464.1_g000006
rosa_roxburghii	Rroxscaffold_5G00365130
rosa_rugosa	Rorug04G0183300.1
rosa_samantha	Rh4AG243100 Rh4BG247800 Rh4CG257600 Rh4DG242800
rosa_wichuraiana	Rw4G020970

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AciI	CCGC	2 cut(s)	185, 232
AcsI	RAATTY	1 cut(s)	175
AcuI	CTGAAG	1 cut(s)	284
AfiI	CCNNNNNNNGG	2 cut(s)	231, 244
AgsI	TTSAA	2 cut(s)	105, 217
AjnI	CCWGG	1 cut(s)	243
AluBI	AGCT	2 cut(s)	31, 113
AluI	AGCT	2 cut(s)	31, 113
AlwNI	CAGNNNCTG	1 cut(s)	307
AoxI	GGCC	2 cut(s)	222, 318
ApeKI	GCWGC	1 cut(s)	307
ApoI	RAATTY	1 cut(s)	175
AspLEI	GCGC	1 cut(s)	45
AsuHPI	GGTGA	1 cut(s)	42
BbvI	GCAGC	1 cut(s)	294
BccI	CCATC	3 cut(s)	28, 61, 310
BciT130I	CCWGG	1 cut(s)	245
BfaI	CTAG	1 cut(s)	290
BfoI	RGCGCY	1 cut(s)	46
BisI	GCNGC	1 cut(s)	308
BlsI	GCNGC	1 cut(s)	309
Bme1390I	CCNGG	1 cut(s)	245
BmiI	GGNNCC	1 cut(s)	236
BmrFI	CCNGG	1 cut(s)	245
BpuEI	CTTGAG	1 cut(s)	40
Bsc4I	CCNNNNNNNGG	2 cut(s)	231, 244
BseBI	CCWGG	1 cut(s)	245
BseLI	CCNNNNNNNGG	2 cut(s)	231, 244
BseMII	CTCAG	1 cut(s)	118
BseRI	GAGGAG	2 cut(s)	133, 144
BseXI	GCAGC	1 cut(s)	294
BshFI	GGCC	2 cut(s)	224, 320
BslI	CCNNNNNNNGG	2 cut(s)	231, 244
BsnI	GGCC	2 cut(s)	224, 320
BspACI	CCGC	2 cut(s)	185, 232
BspANI	GGCC	2 cut(s)	224, 320
BspCNI	CTCAG	1 cut(s)	119
BspLI	GGNNCC	1 cut(s)	236
Bst2UI	CCWGG	1 cut(s)	245
Bst4CI	ACNGT	2 cut(s)	15, 277
BstDEI	CTNAG	1 cut(s)	127
BstH2I	RGCGCY	1 cut(s)	46
BstHHI	GCGC	1 cut(s)	45
BstNI	CCWGG	1 cut(s)	245
BstSCI	CCNGG	1 cut(s)	243
BstV1I	GCAGC	1 cut(s)	294
BsuRI	GGCC	2 cut(s)	224, 320
BtsIMutI	CAGTG	1 cut(s)	282
CaiI	CAGNNNCTG	1 cut(s)	307
CfoI	GCGC	1 cut(s)	45
CviJI	RGCY	8 cut(s)	31, 101, 113, 124, 224, 237, 243, 320
CviKI_1	RGCY	8 cut(s)	31, 101, 113, 124, 224, 237, 243, 320
DdeI	CTNAG	1 cut(s)	127
EciI	GGCGGA	1 cut(s)	200
Eco57I	CTGAAG	1 cut(s)	284
EcoRII	CCWGG	1 cut(s)	243
FaiI	YATR	3 cut(s)	116, 251, 253
Fnu4HI	GCNGC	1 cut(s)	308
Fsp4HI	GCNGC	1 cut(s)	308
FspBI	CTAG	1 cut(s)	290
GlaI	GCGC	1 cut(s)	44
GluI	GCNGC	1 cut(s)	308
HaeII	RGCGCY	1 cut(s)	46
HaeIII	GGCC	2 cut(s)	224, 320
HhaI	GCGC	1 cut(s)	45
Hin6I	GCGC	1 cut(s)	43
HinP1I	GCGC	1 cut(s)	43
HphI	GGTGA	1 cut(s)	42
Hpy166II	GTNNAC	1 cut(s)	211
Hpy188I	TCNGA	1 cut(s)	128
Hpy8I	GTNNAC	1 cut(s)	211
HpyAV	CCTTC	2 cut(s)	277, 308
HpyCH4III	ACNGT	2 cut(s)	15, 277
HpyCH4V	TGCA	1 cut(s)	166
HpyF3I	CTNAG	1 cut(s)	127
HspAI	GCGC	1 cut(s)	43
LmnI	GCTCC	2 cut(s)	28, 234
LpnPI	CCDG	6 cut(s)	80, 146, 167, 230, 238, 257
Lsp1109I	GCAGC	1 cut(s)	294
MaeI	CTAG	1 cut(s)	290
MaeIII	GTNAC	1 cut(s)	156
MboII	GAAGA	1 cut(s)	148
MfeI	CAATTG	1 cut(s)	149
MluCI	AATT	3 cut(s)	72, 149, 175
MmeI	TCCRAC	1 cut(s)	6
MnlI	CCTC	9 cut(s)	15, 74, 88, 111, 114, 122, 163, 214, 255
MseI	TTAA	1 cut(s)	143
MspR9I	CCNGG	1 cut(s)	245
MunI	CAATTG	1 cut(s)	149
MvaI	CCWGG	1 cut(s)	245
NlaIV	GGNNCC	1 cut(s)	236
PkrI	GCNGC	1 cut(s)	309
Psp6I	CCWGG	1 cut(s)	243
PspGI	CCWGG	1 cut(s)	243
PspN4I	GGNNCC	1 cut(s)	236
PstNI	CAGNNNCTG	1 cut(s)	307
SaqAI	TTAA	1 cut(s)	143
SatI	GCNGC	1 cut(s)	308
ScrFI	CCNGG	1 cut(s)	245
SetI	ASST	7 cut(s)	26, 33, 115, 165, 266, 288, 300
SmlI	CTYRAG	1 cut(s)	19
SmoI	CTYRAG	1 cut(s)	19
Sse9I	AATT	3 cut(s)	72, 149, 175
SsiI	CCGC	2 cut(s)	185, 232
SspMI	CTAG	1 cut(s)	290
StyD4I	CCNGG	1 cut(s)	243
TaaI	ACNGT	2 cut(s)	15, 277
TasI	AATT	3 cut(s)	72, 149, 175
Tru1I	TTAA	1 cut(s)	143
Tru9I	TTAA	1 cut(s)	143
TscAI	CASTG	1 cut(s)	282
TseI	GCWGC	1 cut(s)	307
TspRI	CASTG	1 cut(s)	282
XapI	RAATTY	1 cut(s)	175
XspI	CTAG	1 cut(s)	290

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.