Rmu_co8123160.1_g000001

Ubiquinol-cytochrome-c reductase complex assembly factor

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co8123160.1
Physical Location & Seq
Forward (+)
1 .. 616
616 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co8123160.1_g000001.1.cds

Sequence Viewer

Length: 426 bp
gtgaatttggacaagctgttttggtctaagccttgctcgttggctttgcctccggagtcgccgttgaggattgatgagccggagtatgagggcattaagcgtgtgtttcttaagctgatgctgttttacagcaagcaaagcaagtcgattcggggggcgaatgtggtgtacaagagagtcgtttcccaagttgataaaccggccatatacgaagtgttcaacttggagaaaacttttaagacgacgtatgctttgcttgtacttcatatgtggctttgcttacgccggttgaaacaagagggaaaagaaggtgttgagttcgggcaatatgtgtatgagatttacaaccatgatgtggaacttagagtctctaaggctggggtatgtgattcttatacgttaagctctttgaacttgaatgcttaa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

141

Amino Acids

16.36

Weight (kDa)

8.92

Isoelectric Point (pI)

42.19

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 355
AccIII TCCGGA 1 cut(s) 52
AcoI YGGCCR 1 cut(s) 201
AcsI RAATTY 1 cut(s) 4
AfaI GTAC 2 cut(s) 170, 261
AfiI CCNNNNNNNGG 1 cut(s) 355
AflII CTTAAG 1 cut(s) 110
AgsI TTSAA 4 cut(s) 220, 292, 412, 418
AluBI AGCT 3 cut(s) 16, 115, 405
AluI AGCT 3 cut(s) 16, 115, 405
Alw26I GTCTC 1 cut(s) 373
Aor13HI TCCGGA 1 cut(s) 52
AoxI GGCC 1 cut(s) 201
ApoI RAATTY 1 cut(s) 4
ArsI GACNNNNNNTTYG 2 cut(s) 235, 267
BceAI ACGGC 1 cut(s) 46
BcoDI GTCTC 1 cut(s) 373
BfrI CTTAAG 1 cut(s) 110
BmsI GCATC 1 cut(s) 108
BsaWI WCCGGW 1 cut(s) 52
BsaXI ACNNNNNCTCC 2 cut(s) 47, 77
Bsc4I CCNNNNNNNGG 1 cut(s) 355
Bse118I RCCGGY 2 cut(s) 199, 285
BseAI TCCGGA 1 cut(s) 52
BseLI CCNNNNNNNGG 1 cut(s) 355
BseYI CCCAGC 1 cut(s) 377
BshFI GGCC 1 cut(s) 203
BsiSI CCGG 4 cut(s) 53, 80, 200, 286
BslI CCNNNNNNNGG 1 cut(s) 355
BsmAI GTCTC 1 cut(s) 373
BsmI GAATGC 1 cut(s) 424
BsnI GGCC 1 cut(s) 203
Bsp13I TCCGGA 1 cut(s) 52
Bsp1407I TGTACA 1 cut(s) 168
BspANI GGCC 1 cut(s) 203
BspEI TCCGGA 1 cut(s) 52
BspTI CTTAAG 1 cut(s) 110
BsrFI RCCGGY 2 cut(s) 199, 285
BsrGI TGTACA 1 cut(s) 168
BssAI RCCGGY 2 cut(s) 199, 285
BstAFI CTTAAG 1 cut(s) 110
BstAUI TGTACA 1 cut(s) 168
BstC8I GCNNGC 1 cut(s) 134
BstDEI CTNAG 3 cut(s) 27, 362, 372
BstMAI GTCTC 1 cut(s) 373
BstMWI GCNNNNNNNGC 1 cut(s) 138
BsuRI GGCC 1 cut(s) 203
Cac8I GCNNGC 1 cut(s) 134
Cfr10I RCCGGY 2 cut(s) 199, 285
Csp6I GTAC 2 cut(s) 169, 260
CviAII CATG 1 cut(s) 350
CviJI RGCY 9 cut(s) 16, 31, 44, 79, 115, 203, 274, 377, 405
CviKI_1 RGCY 9 cut(s) 16, 31, 44, 79, 115, 203, 274, 377, 405
CviQI GTAC 2 cut(s) 169, 260
DdeI CTNAG 3 cut(s) 27, 362, 372
EaeI YGGCCR 1 cut(s) 201
FaeI CATG 1 cut(s) 353
FatI CATG 1 cut(s) 349
FauNDI CATATG 1 cut(s) 267
GsaI CCCAGC 1 cut(s) 381
HaeIII GGCC 1 cut(s) 203
HapII CCGG 4 cut(s) 53, 80, 200, 286
Hin1II CATG 1 cut(s) 353
HinfI GANTC 5 cut(s) 56, 148, 177, 366, 389
HpaII CCGG 4 cut(s) 53, 80, 200, 286
Hpy166II GTNNAC 1 cut(s) 169
Hpy188III TCNNGA 1 cut(s) 53
Hpy8I GTNNAC 1 cut(s) 169
Hpy99I CGWCG 1 cut(s) 247
HpyAV CCTTC 1 cut(s) 302
HpyCH4IV ACGT 2 cut(s) 245, 398
HpyF10VI GCNNNNNNNGC 1 cut(s) 138
HpyF3I CTNAG 3 cut(s) 27, 362, 372
HpySE526I ACGT 2 cut(s) 245, 398
Hsp92II CATG 1 cut(s) 353
Kpn2I TCCGGA 1 cut(s) 52
LpnPI CCDG 5 cut(s) 66, 93, 213, 299, 363
LweI GCATC 1 cut(s) 108
MaeII ACGT 2 cut(s) 245, 398
MluCI AATT 1 cut(s) 4
MlyI GAGTC 3 cut(s) 65, 186, 375
MnlI CCTC 4 cut(s) 60, 60, 82, 292
MroI TCCGGA 1 cut(s) 52
MseI TTAA 5 cut(s) 96, 111, 237, 401, 424
MspCI CTTAAG 1 cut(s) 110
MspI CCGG 4 cut(s) 53, 80, 200, 286
Mva1269I GAATGC 1 cut(s) 424
MwoI GCNNNNNNNGC 1 cut(s) 138
NdeI CATATG 1 cut(s) 267
NlaIII CATG 1 cut(s) 353
PctI GAATGC 1 cut(s) 424
PfeI GAWTC 2 cut(s) 148, 389
PflMI CCANNNNNTGG 1 cut(s) 355
PleI GAGTC 3 cut(s) 64, 185, 374
PpsI GAGTC 3 cut(s) 64, 185, 374
PspFI CCCAGC 1 cut(s) 377
RsaI GTAC 2 cut(s) 170, 261
RsaNI GTAC 2 cut(s) 169, 260
SaqAI TTAA 5 cut(s) 96, 111, 237, 401, 424
SchI GAGTC 3 cut(s) 65, 186, 375
SetI ASST 6 cut(s) 18, 117, 248, 313, 401, 407
SfaNI GCATC 1 cut(s) 108
SmlI CTYRAG 1 cut(s) 110
SmoI CTYRAG 1 cut(s) 110
Sse9I AATT 1 cut(s) 4
TaiI ACGT 2 cut(s) 248, 401
TaqI TCGA 1 cut(s) 146
TasI AATT 1 cut(s) 4
TatI WGTACW 2 cut(s) 168, 259
TfiI GAWTC 2 cut(s) 148, 389
Tru1I TTAA 5 cut(s) 96, 111, 237, 401, 424
Tru9I TTAA 5 cut(s) 96, 111, 237, 401, 424
TspDTI ATGAA 1 cut(s) 254
Van91I CCANNNNNTGG 1 cut(s) 355
Vha464I CTTAAG 1 cut(s) 110
XapI RAATTY 1 cut(s) 4
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.