Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_co8136594.1

Orthogroup ID

OG0013762

Physical Location & Seq

Genomic Coordinates Forward (+)

1 .. 465

Gene Structure 465 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_co8136594.1_g000001.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 465 bp

aagaagccgtggagagggagagtgaaccagtgtgaaaatgacgatgttgagaaaggtatggtccaagatgatggctctatagcagggtttgacactttggggaggattacgcacaagaacattatgaagctttggtattgttgtactactagagactgccagcagctgttggtttatgattacatgccaaatggtagtcttggtgattgtctgcacaataagaaagcacggttgctgaattggcctacaaggtttaagattgctcttggtgctgctgaggggatttcttatctgcaccatgattgttctccttctattgttcatagaaatgtgaaatcaaacaatatattgttggatggtgatttcggagctcgagtggtggatattggaacaactaatggcgttgatgcatctgtaaaagggccagtcattgcagctgcttgtggttacattgctccaggttag

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

LRRNT_2 LRR_1 LRR_8 Pkinase

Protein Analysis

154

Amino Acids

16.88

Weight (kDa)

8.2

Isoelectric Point (pI)

30.15

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0013762)

Species	Orthologous Gene IDs
rosa_chinensis	RchiOBHm_Chr5g0009251 RchiOBHm_Chr5g0035201
rosa_laevigata	RLG00000031650
rosa_multiflora	Rmu_co8136594.1_g000001 Rmu_sc0006233.1_g000004 Rmu_sc0006233.1_g000016 Rmu_sc0008176.1_g000004 Rmu_sc0009464.1_g000001
rosa_roxburghii	Rroxscaffold_1G00045190
rosa_samantha	Rh5AG071600 Rh5AG072400 Rh5BG243000 Rh5CG080600 Rh5CG081300 Rh5DG068200 Rh5DG069000
rosa_wichuraiana	Rw5G006700 Rw5G006760

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AfaI	GTAC	1 cut(s)	145
AfiI	CCNNNNNNNGG	1 cut(s)	14
AjnI	CCWGG	1 cut(s)	457
AluBI	AGCT	4 cut(s)	130, 166, 371, 437
AluI	AGCT	4 cut(s)	130, 166, 371, 437
Alw21I	GWGCWC	1 cut(s)	373
Alw26I	GTCTC	1 cut(s)	147
AlwNI	CAGNNNCTG	1 cut(s)	166
Ama87I	CYCGRG	1 cut(s)	372
AoxI	GGCC	2 cut(s)	242, 422
ApeKI	GCWGC	4 cut(s)	163, 272, 434, 437
AspS9I	GGNCC	2 cut(s)	61, 422
AsuHPI	GGTGA	2 cut(s)	215, 371
AvaI	CYCGRG	1 cut(s)	372
AvaII	GGWCC	1 cut(s)	61
BanII	GRGCYC	1 cut(s)	373
Bbv12I	GWGCWC	1 cut(s)	373
BbvCI	CCTCAGC	1 cut(s)	276
BbvI	GCAGC	4 cut(s)	175, 259, 424, 446
BccI	CCATC	2 cut(s)	65, 350
BciT130I	CCWGG	1 cut(s)	459
BcoDI	GTCTC	1 cut(s)	147
BfaI	CTAG	1 cut(s)	150
BfmI	CTRYAG	1 cut(s)	78
BisI	GCNGC	4 cut(s)	164, 273, 435, 438
BlsI	GCNGC	4 cut(s)	165, 274, 436, 439
Bme1390I	CCNGG	1 cut(s)	459
Bme18I	GGWCC	1 cut(s)	61
BmeT110I	CYCGRG	1 cut(s)	372
BmgT120I	GGNCC	2 cut(s)	61, 422
BmrFI	CCNGG	1 cut(s)	459
BmsI	GCATC	2 cut(s)	397, 419
BpmI	CTGGAG	1 cut(s)	441
Bpu10I	CCTNAGC	1 cut(s)	276
BsaJI	CCNNGG	1 cut(s)	8
BsaXI	ACNNNNNCTCC	2 cut(s)	360, 390
Bsc4I	CCNNNNNNNGG	1 cut(s)	14
Bse1I	ACTGG	2 cut(s)	28, 425
Bse3DI	GCAATG	2 cut(s)	429, 450
BseBI	CCWGG	1 cut(s)	459
BseDI	CCNNGG	1 cut(s)	8
BseGI	GGATG	1 cut(s)	361
BseLI	CCNNNNNNNGG	1 cut(s)	14
BseMI	GCAATG	2 cut(s)	429, 450
BseMII	CTCAG	1 cut(s)	267
BseNI	ACTGG	2 cut(s)	28, 425
BseXI	GCAGC	4 cut(s)	175, 259, 424, 446
BsgI	GTGCAG	2 cut(s)	197, 278
BshFI	GGCC	2 cut(s)	244, 424
BsiHKAI	GWGCWC	1 cut(s)	373
BsiHKCI	CYCGRG	1 cut(s)	372
BslI	CCNNNNNNNGG	1 cut(s)	14
BsmAI	GTCTC	1 cut(s)	147
BsnI	GGCC	2 cut(s)	244, 424
BsoBI	CYCGRG	1 cut(s)	372
Bsp1286I	GDGCHC	1 cut(s)	373
BspANI	GGCC	2 cut(s)	244, 424
BspCNI	CTCAG	1 cut(s)	268
BsrDI	GCAATG	2 cut(s)	429, 450
BsrI	ACTGG	2 cut(s)	28, 425
BssECI	CCNNGG	1 cut(s)	8
Bst2UI	CCWGG	1 cut(s)	459
Bst4CI	ACNGT	1 cut(s)	231
BstC8I	GCNNGC	1 cut(s)	161
BstDEI	CTNAG	1 cut(s)	276
BstDSI	CCRYGG	1 cut(s)	8
BstF5I	GGATG	1 cut(s)	361
BstMAI	GTCTC	1 cut(s)	147
BstMWI	GCNNNNNNNGC	2 cut(s)	241, 269
BstNI	CCWGG	1 cut(s)	459
BstNSI	RCATGY	1 cut(s)	187
BstSCI	CCNGG	1 cut(s)	457
BstSFI	CTRYAG	1 cut(s)	78
BstV1I	GCAGC	4 cut(s)	175, 259, 424, 446
BstXI	CCANNNNNNTGG	1 cut(s)	71
BsuRI	GGCC	2 cut(s)	244, 424
BtgI	CCRYGG	1 cut(s)	8
BtsCI	GGATG	1 cut(s)	361
BtsIMutI	CAGTG	1 cut(s)	35
Cac8I	GCNNGC	1 cut(s)	161
CaiI	CAGNNNCTG	1 cut(s)	166
Cfr13I	GGNCC	2 cut(s)	61, 422
Csp6I	GTAC	1 cut(s)	144
CviAII	CATG	2 cut(s)	184, 299
CviJI	RGCY	8 cut(s)	7, 75, 130, 166, 244, 371, 424, 437
CviKI_1	RGCY	8 cut(s)	7, 75, 130, 166, 244, 371, 424, 437
CviQI	GTAC	1 cut(s)	144
DdeI	CTNAG	1 cut(s)	276
Ecl136II	GAGCTC	1 cut(s)	371
Eco24I	GRGCYC	1 cut(s)	373
Eco47I	GGWCC	1 cut(s)	61
Eco53kI	GAGCTC	1 cut(s)	371
Eco88I	CYCGRG	1 cut(s)	372
EcoICRI	GAGCTC	1 cut(s)	371
EcoRII	CCWGG	1 cut(s)	457
EcoT22I	ATGCAT	1 cut(s)	412
EcoT38I	GRGCYC	1 cut(s)	373
FaeI	CATG	2 cut(s)	187, 302
FaiI	YATR	8 cut(s)	59, 80, 125, 177, 185, 300, 324, 347
FatI	CATG	2 cut(s)	183, 298
Fnu4HI	GCNGC	4 cut(s)	164, 273, 435, 438
FokI	GGATG	1 cut(s)	368
FriOI	GRGCYC	1 cut(s)	373
Fsp4HI	GCNGC	4 cut(s)	164, 273, 435, 438
FspBI	CTAG	1 cut(s)	150
GluI	GCNGC	4 cut(s)	164, 273, 435, 438
GsuI	CTGGAG	1 cut(s)	441
HaeIII	GGCC	2 cut(s)	244, 424
Hin1II	CATG	2 cut(s)	187, 302
HindIII	AAGCTT	1 cut(s)	128
HphI	GGTGA	2 cut(s)	215, 371
Hpy166II	GTNNAC	1 cut(s)	25
Hpy188I	TCNGA	1 cut(s)	368
Hpy8I	GTNNAC	1 cut(s)	25
HpyAV	CCTTC	1 cut(s)	321
HpyCH4III	ACNGT	1 cut(s)	231
HpyCH4V	TGCA	4 cut(s)	214, 295, 410, 434
HpyF10VI	GCNNNNNNNGC	2 cut(s)	241, 269
HpyF3I	CTNAG	1 cut(s)	276
Hsp92II	CATG	2 cut(s)	187, 302
LmnI	GCTCC	2 cut(s)	368, 460
LpnPI	CCDG	5 cut(s)	41, 69, 173, 438, 444
Lsp1109I	GCAGC	4 cut(s)	175, 259, 424, 446
LweI	GCATC	2 cut(s)	397, 419
MaeI	CTAG	1 cut(s)	150
MaeIII	GTNAC	1 cut(s)	446
MhlI	GDGCHC	1 cut(s)	373
MluCI	AATT	1 cut(s)	238
MmeI	TCCRAC	1 cut(s)	333
MnlI	CCTC	3 cut(s)	8, 96, 271
Mph1103I	ATGCAT	1 cut(s)	412
MseI	TTAA	1 cut(s)	255
MslI	CAYNNNNRTG	1 cut(s)	327
MspA1I	CMGCKG	2 cut(s)	166, 437
MspR9I	CCNGG	1 cut(s)	459
MvaI	CCWGG	1 cut(s)	459
MwoI	GCNNNNNNNGC	2 cut(s)	241, 269
NlaIII	CATG	2 cut(s)	187, 302
NsiI	ATGCAT	1 cut(s)	412
NspI	RCATGY	1 cut(s)	187
PaeR7I	CTCGAG	1 cut(s)	372
PkrI	GCNGC	4 cut(s)	165, 274, 436, 439
Psp124BI	GAGCTC	1 cut(s)	373
Psp6I	CCWGG	1 cut(s)	457
PspGI	CCWGG	1 cut(s)	457
PspPI	GGNCC	2 cut(s)	61, 422
PspXI	VCTCGAGB	1 cut(s)	372
PstNI	CAGNNNCTG	1 cut(s)	166
PvuII	CAGCTG	2 cut(s)	166, 437
RsaI	GTAC	1 cut(s)	145
RsaNI	GTAC	1 cut(s)	144
RseI	CAYNNNNRTG	1 cut(s)	327
SacI	GAGCTC	1 cut(s)	373
SaqAI	TTAA	1 cut(s)	255
SatI	GCNGC	4 cut(s)	164, 273, 435, 438
Sau96I	GGNCC	2 cut(s)	61, 422
ScrFI	CCNGG	1 cut(s)	459
SduI	GDGCHC	1 cut(s)	373
SetI	ASST	7 cut(s)	58, 132, 168, 254, 373, 439, 463
SfaNI	GCATC	2 cut(s)	397, 419
SfcI	CTRYAG	1 cut(s)	78
Sfr274I	CTCGAG	1 cut(s)	372
SinI	GGWCC	1 cut(s)	61
SlaI	CTCGAG	1 cut(s)	372
SmiMI	CAYNNNNRTG	1 cut(s)	327
SmlI	CTYRAG	1 cut(s)	372
SmoI	CTYRAG	1 cut(s)	372
Sse9I	AATT	1 cut(s)	238
SspMI	CTAG	1 cut(s)	150
SstI	GAGCTC	1 cut(s)	373
StyD4I	CCNGG	1 cut(s)	457
TaaI	ACNGT	1 cut(s)	231
TaqI	TCGA	1 cut(s)	373
TasI	AATT	1 cut(s)	238
TatI	WGTACW	1 cut(s)	143
Tru1I	TTAA	1 cut(s)	255
Tru9I	TTAA	1 cut(s)	255
TscAI	CASTG	1 cut(s)	35
TseI	GCWGC	4 cut(s)	163, 272, 434, 437
TspDTI	ATGAA	2 cut(s)	140, 311
TspRI	CASTG	1 cut(s)	35
VpaK11BI	GGWCC	1 cut(s)	61
XceI	RCATGY	1 cut(s)	187
XhoI	CTCGAG	1 cut(s)	372
XspI	CTAG	1 cut(s)	150
Zsp2I	ATGCAT	1 cut(s)	412

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.