Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0006233.1

Orthogroup ID

OG0013762

Physical Location & Seq

Genomic Coordinates Forward (+)

84205 .. 84708

Gene Structure 504 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0006233.1_g000016.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 504 bp

atgatctttcctacagcttggcttgcaaacccttccagttacgtgtttcagagaaaacttgtgtatggtaactcgagcccatcactcgttagcatcaagttcgtaatcctcatatcatgtttcctaccggccttgggattctttgcttattcagcaaagcaattcaaggaaacgctctatctaataggctcaaaagacgaaagagctgatgaggccagggcaatcagggcttttataaggggaactactttcttctcgcttgggatcagatgtctactatgtgctggcccttcgctactatggttttttggccctatccccatgtttgtgtcctctgttgctttagtgatatccctccatgtcgctggcaatcgtgccagtccacaattgcatgttcttcctgagaatacggatgaaagtcacggagacaattccaatattgcaaaggaagaagcatatgatcactctagtattgatatagagatgccccctcctggtgtttag

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

DUF599

Protein Analysis

167

Amino Acids

18.37

Weight (kDa)

6.4

Isoelectric Point (pI)

45.07

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0013762)

Species	Orthologous Gene IDs
rosa_chinensis	RchiOBHm_Chr5g0009251 RchiOBHm_Chr5g0035201
rosa_laevigata	RLG00000031650
rosa_multiflora	Rmu_co8136594.1_g000001 Rmu_sc0006233.1_g000004 Rmu_sc0006233.1_g000016 Rmu_sc0008176.1_g000004 Rmu_sc0009464.1_g000001
rosa_roxburghii	Rroxscaffold_1G00045190
rosa_samantha	Rh5AG071600 Rh5AG072400 Rh5BG243000 Rh5CG080600 Rh5CG081300 Rh5DG068200 Rh5DG069000
rosa_wichuraiana	Rw5G006700 Rw5G006760

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AanI	TTATAA	1 cut(s)	236
AccI	GTMKAC	1 cut(s)	274
AclWI	GGATC	1 cut(s)	272
AfiI	CCNNNNNNNGG	2 cut(s)	134, 494
AflIII	ACRYGT	1 cut(s)	42
AgsI	TTSAA	1 cut(s)	166
AjnI	CCWGG	2 cut(s)	215, 493
AluBI	AGCT	2 cut(s)	17, 206
AluI	AGCT	2 cut(s)	17, 206
Alw26I	GTCTC	1 cut(s)	420
AlwI	GGATC	1 cut(s)	272
Ama87I	CYCGRG	1 cut(s)	73
AoxI	GGCC	4 cut(s)	129, 213, 286, 310
AspS9I	GGNCC	2 cut(s)	287, 311
AvaI	CYCGRG	1 cut(s)	73
BanII	GRGCYC	1 cut(s)	80
BccI	CCATC	1 cut(s)	88
BcgI	CGANNNNNNTGC	2 cut(s)	82, 116
BciT130I	CCWGG	2 cut(s)	217, 495
BclI	TGATCA	1 cut(s)	460
BcoDI	GTCTC	1 cut(s)	420
BfaI	CTAG	1 cut(s)	468
BfmI	CTRYAG	1 cut(s)	12
Bme1390I	CCNGG	2 cut(s)	217, 495
BmeT110I	CYCGRG	1 cut(s)	73
BmgT120I	GGNCC	2 cut(s)	287, 311
BmrFI	CCNGG	2 cut(s)	217, 495
BmsI	GCATC	2 cut(s)	102, 474
BsaAI	YACGTR	1 cut(s)	43
BsaJI	CCNNGG	2 cut(s)	132, 216
Bsc4I	CCNNNNNNNGG	2 cut(s)	134, 494
Bse118I	RCCGGY	1 cut(s)	127
Bse1I	ACTGG	2 cut(s)	36, 378
BseBI	CCWGG	2 cut(s)	217, 495
BseDI	CCNNGG	2 cut(s)	132, 216
BseGI	GGATG	1 cut(s)	418
BseLI	CCNNNNNNNGG	2 cut(s)	134, 494
BseMII	CTCAG	1 cut(s)	393
BseNI	ACTGG	2 cut(s)	36, 378
BshFI	GGCC	4 cut(s)	131, 215, 288, 312
BsiHKCI	CYCGRG	1 cut(s)	73
BsiSI	CCGG	1 cut(s)	128
BslI	CCNNNNNNNGG	2 cut(s)	134, 494
BsmAI	GTCTC	1 cut(s)	420
BsnI	GGCC	4 cut(s)	131, 215, 288, 312
BsoBI	CYCGRG	1 cut(s)	73
Bsp1286I	GDGCHC	1 cut(s)	80
Bsp143I	GATC	3 cut(s)	3, 264, 460
BspANI	GGCC	4 cut(s)	131, 215, 288, 312
BspCNI	CTCAG	1 cut(s)	394
BspPI	GGATC	1 cut(s)	272
BsrFI	RCCGGY	1 cut(s)	127
BsrI	ACTGG	2 cut(s)	36, 378
BssAI	RCCGGY	1 cut(s)	127
BssECI	CCNNGG	2 cut(s)	132, 216
BssMI	GATC	3 cut(s)	3, 264, 460
BssT1I	CCWWGG	1 cut(s)	132
Bst2UI	CCWGG	2 cut(s)	217, 495
BstBAI	YACGTR	1 cut(s)	43
BstC8I	GCNNGC	3 cut(s)	24, 286, 367
BstDEI	CTNAG	1 cut(s)	402
BstF5I	GGATG	1 cut(s)	418
BstKTI	GATC	3 cut(s)	6, 267, 463
BstMAI	GTCTC	1 cut(s)	420
BstMBI	GATC	3 cut(s)	3, 264, 460
BstMWI	GCNNNNNNNGC	4 cut(s)	23, 152, 212, 227
BstNI	CCWGG	2 cut(s)	217, 495
BstNSI	RCATGY	1 cut(s)	395
BstSCI	CCNGG	2 cut(s)	215, 493
BstSFI	CTRYAG	1 cut(s)	12
BstXI	CCANNNNNNTGG	1 cut(s)	365
BsuRI	GGCC	4 cut(s)	131, 215, 288, 312
BtsCI	GGATG	1 cut(s)	418
Cac8I	GCNNGC	3 cut(s)	24, 286, 367
Cfr10I	RCCGGY	1 cut(s)	127
Cfr13I	GGNCC	2 cut(s)	287, 311
CviAII	CATG	4 cut(s)	117, 322, 359, 392
DdeI	CTNAG	1 cut(s)	402
DpnI	GATC	3 cut(s)	5, 266, 462
DpnII	GATC	3 cut(s)	3, 264, 460
Eco130I	CCWWGG	1 cut(s)	132
Eco24I	GRGCYC	1 cut(s)	80
Eco32I	GATATC	1 cut(s)	351
Eco88I	CYCGRG	1 cut(s)	73
EcoRII	CCWGG	2 cut(s)	215, 493
EcoRV	GATATC	1 cut(s)	351
EcoT14I	CCWWGG	1 cut(s)	132
EcoT38I	GRGCYC	1 cut(s)	80
ErhI	CCWWGG	1 cut(s)	132
FaeI	CATG	4 cut(s)	120, 325, 362, 395
FatI	CATG	4 cut(s)	116, 321, 358, 391
FauNDI	CATATG	1 cut(s)	457
FbaI	TGATCA	1 cut(s)	460
FblI	GTMKAC	1 cut(s)	274
FokI	GGATG	1 cut(s)	425
FriOI	GRGCYC	1 cut(s)	80
FspBI	CTAG	1 cut(s)	468
HaeIII	GGCC	4 cut(s)	131, 215, 288, 312
HapII	CCGG	1 cut(s)	128
Hin1II	CATG	4 cut(s)	120, 325, 362, 395
HinfI	GANTC	1 cut(s)	138
HpaII	CCGG	1 cut(s)	128
Hpy166II	GTNNAC	2 cut(s)	275, 383
Hpy188I	TCNGA	2 cut(s)	51, 269
Hpy188III	TCNNGA	1 cut(s)	401
Hpy8I	GTNNAC	2 cut(s)	275, 383
HpyAV	CCTTC	2 cut(s)	42, 300
HpyCH4IV	ACGT	1 cut(s)	42
HpyCH4V	TGCA	3 cut(s)	26, 391, 443
HpyF10VI	GCNNNNNNNGC	4 cut(s)	23, 152, 212, 227
HpyF3I	CTNAG	1 cut(s)	402
HpySE526I	ACGT	1 cut(s)	42
Hsp92II	CATG	4 cut(s)	120, 325, 362, 395
Ksp22I	TGATCA	1 cut(s)	460
Kzo9I	GATC	3 cut(s)	3, 264, 460
LweI	GCATC	2 cut(s)	102, 474
MaeI	CTAG	1 cut(s)	468
MaeII	ACGT	1 cut(s)	42
MaeIII	GTNAC	3 cut(s)	38, 68, 419
MalI	GATC	3 cut(s)	5, 266, 462
MboI	GATC	3 cut(s)	3, 264, 460
MboII	GAAGA	3 cut(s)	244, 389, 461
MfeI	CAATTG	1 cut(s)	386
MhlI	GDGCHC	1 cut(s)	80
MluCI	AATT	3 cut(s)	161, 386, 430
MnlI	CCTC	5 cut(s)	119, 205, 343, 365, 501
MslI	CAYNNNNRTG	1 cut(s)	326
MspI	CCGG	1 cut(s)	128
MspR9I	CCNGG	2 cut(s)	217, 495
MunI	CAATTG	1 cut(s)	386
MvaI	CCWGG	2 cut(s)	217, 495
MwoI	GCNNNNNNNGC	4 cut(s)	23, 152, 212, 227
NdeI	CATATG	1 cut(s)	457
NdeII	GATC	3 cut(s)	3, 264, 460
NlaIII	CATG	4 cut(s)	120, 325, 362, 395
NmuCI	GTSAC	1 cut(s)	419
NspI	RCATGY	1 cut(s)	395
PaeR7I	CTCGAG	1 cut(s)	73
PfeI	GAWTC	1 cut(s)	138
Ppu21I	YACGTR	1 cut(s)	43
PsiI	TTATAA	1 cut(s)	236
Psp6I	CCWGG	2 cut(s)	215, 493
PspGI	CCWGG	2 cut(s)	215, 493
PspPI	GGNCC	2 cut(s)	287, 311
PspXI	VCTCGAGB	1 cut(s)	73
RseI	CAYNNNNRTG	1 cut(s)	326
Sau3AI	GATC	3 cut(s)	3, 264, 460
Sau96I	GGNCC	2 cut(s)	287, 311
ScrFI	CCNGG	2 cut(s)	217, 495
SduI	GDGCHC	1 cut(s)	80
SetI	ASST	3 cut(s)	19, 45, 208
SfaNI	GCATC	2 cut(s)	102, 474
SfcI	CTRYAG	1 cut(s)	12
Sfr274I	CTCGAG	1 cut(s)	73
SlaI	CTCGAG	1 cut(s)	73
SmiMI	CAYNNNNRTG	1 cut(s)	326
SmlI	CTYRAG	1 cut(s)	73
SmoI	CTYRAG	1 cut(s)	73
Sse9I	AATT	3 cut(s)	161, 386, 430
SspI	AATATT	1 cut(s)	439
SspMI	CTAG	1 cut(s)	468
StyD4I	CCNGG	2 cut(s)	215, 493
StyI	CCWWGG	1 cut(s)	132
TaiI	ACGT	1 cut(s)	45
TaqI	TCGA	1 cut(s)	74
TasI	AATT	3 cut(s)	161, 386, 430
TfiI	GAWTC	1 cut(s)	138
TseFI	GTSAC	1 cut(s)	419
Tsp45I	GTSAC	1 cut(s)	419
TspDTI	ATGAA	1 cut(s)	429
TspGWI	ACGGA	2 cut(s)	425, 438
XceI	RCATGY	1 cut(s)	395
XhoI	CTCGAG	1 cut(s)	73
XmiI	GTMKAC	1 cut(s)	274
XspI	CTAG	1 cut(s)	468

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.