Rw5G006700

Protein of unknown function, DUF599

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_wichuraiana
Chr5
OG0013762
Physical Location & Seq
Reverse (-)
6947506 .. 6950031
2526 bp
Loading structure...
UTR
Exon/CDS
Intron
Rw5G006700.1

Sequence Viewer

Length: 729 bp
ATGATTTTAATCAAAGAAGAGATGCTTGATCTTCTATTGGTTCCGAGTGCAATACTGATTTTAATTGTCTATATTGTATTCACAAGCGGCAGAGATGGCCACGATGGTCACGGCACCAAAGTGGAGTGGGTGAAAAGAATCATGACGGTTGATACCAGAGAAGGTCTTGCTGCGATCTCATCCAGGATAACAGAAACATATGCTATGTGTGGAGCCTGCTTAATGATCTTTCCTACAGCTTGGCTTGCAAACCCTTCCAGTTACGTGTTTCAGAGAAAACTTGTGTATGGTAACTCGAGCCCATCACTCGTTAGCATCAAGTTCGTAATCCTCATATCATGTTTCCTCCCGGCCTTGGGATTCTTTGCTTATTCAGCAAAGCAATTCAAGGAAACGCTCTATCTAATAGGCTCAAAAGACGAAAGAGCTGATGAGGCCAGGGCAATCAGGGCTTTTATAAGGGGAACTACTTTCTTCTCGCTTGGGATCAGATGTCTACTATGTGCTGGCCCTTCGCTACTATGGTTTTTTGGCCCTATCCCCATGTTTGTGTCCTCTGTTGCTTTAGTCATATCCCTCCATGTCGCTGGCAATCGTGCCAGTCCACAATTGCATGTTCTTCCTGAGAATACGGATGAAAGTCACGGGGACAATTCCAATATTGCAAAGGAAGAAGCATATGGTCACTCTAGTATTGATATAGAGATGCCCCCGCCTCCTGGTGTTTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
DUF599

Protein Analysis

242

Amino Acids

26.57

Weight (kDa)

6.3

Isoelectric Point (pI)

41.02

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
DUF599 PF04654 13 - 194 7.3e-26 Protein of unknown function, DUF599
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 458
AccB1I GGYRCC 1 cut(s) 113
AccI GTMKAC 1 cut(s) 496
AciI CCGC 2 cut(s) 87, 713
AclWI GGATC 1 cut(s) 494
AcoI YGGCCR 1 cut(s) 97
AfiI CCNNNNNNNGG 3 cut(s) 355, 356, 719
AflIII ACRYGT 1 cut(s) 264
AgsI TTSAA 1 cut(s) 388
AjnI CCWGG 3 cut(s) 182, 437, 718
AleI CACNNNNGTG 1 cut(s) 119
AluBI AGCT 2 cut(s) 239, 428
AluI AGCT 2 cut(s) 239, 428
AlwI GGATC 1 cut(s) 494
Ama87I CYCGRG 1 cut(s) 295
AoxI GGCC 5 cut(s) 97, 351, 435, 508, 532
ApeKI GCWGC 1 cut(s) 170
AspS9I GGNCC 2 cut(s) 509, 533
AsuC2I CCSGG 1 cut(s) 350
AsuHPI GGTGA 1 cut(s) 142
AvaI CYCGRG 1 cut(s) 295
BalI TGGCCA 1 cut(s) 99
BanI GGYRCC 1 cut(s) 113
BanII GRGCYC 1 cut(s) 302
BbvI GCAGC 1 cut(s) 157
BccI CCATC 3 cut(s) 89, 98, 310
BceAI ACGGC 1 cut(s) 127
BcgI CGANNNNNNTGC 2 cut(s) 304, 338
BciT130I CCWGG 3 cut(s) 184, 439, 720
BcnI CCSGG 1 cut(s) 350
BfaI CTAG 1 cut(s) 690
BfmI CTRYAG 1 cut(s) 234
BisI GCNGC 2 cut(s) 88, 171
BlsI GCNGC 2 cut(s) 89, 172
Bme1390I CCNGG 4 cut(s) 184, 350, 439, 720
BmeT110I CYCGRG 1 cut(s) 295
BmgT120I GGNCC 2 cut(s) 509, 533
BmiI GGNNCC 3 cut(s) 42, 115, 214
BmrFI CCNGG 4 cut(s) 184, 350, 439, 720
BmsI GCATC 3 cut(s) 12, 324, 696
BpuMI CCSGG 1 cut(s) 350
BsaAI YACGTR 1 cut(s) 265
BsaBI GATNNNNATC 1 cut(s) 8
BsaJI CCNNGG 2 cut(s) 354, 438
Bsc4I CCNNNNNNNGG 3 cut(s) 355, 356, 719
Bse1I ACTGG 2 cut(s) 258, 600
Bse8I GATNNNNATC 1 cut(s) 8
BseBI CCWGG 3 cut(s) 184, 439, 720
BseDI CCNNGG 2 cut(s) 354, 438
BseGI GGATG 2 cut(s) 179, 640
BseJI GATNNNNATC 1 cut(s) 8
BseLI CCNNNNNNNGG 3 cut(s) 355, 356, 719
BseMII CTCAG 1 cut(s) 615
BseNI ACTGG 2 cut(s) 258, 600
BseXI GCAGC 1 cut(s) 157
BshFI GGCC 5 cut(s) 99, 353, 437, 510, 534
BshNI GGYRCC 1 cut(s) 113
BsiHKCI CYCGRG 1 cut(s) 295
BsiSI CCGG 1 cut(s) 350
BslFI GGGAC 1 cut(s) 662
BslI CCNNNNNNNGG 3 cut(s) 355, 356, 719
BsmFI GGGAC 1 cut(s) 662
BsnI GGCC 5 cut(s) 99, 353, 437, 510, 534
BsoBI CYCGRG 1 cut(s) 295
Bsp1286I GDGCHC 1 cut(s) 302
Bsp143I GATC 4 cut(s) 28, 174, 225, 486
BspACI CCGC 2 cut(s) 87, 713
BspANI GGCC 5 cut(s) 99, 353, 437, 510, 534
BspCNI CTCAG 1 cut(s) 616
BspHI TCATGA 1 cut(s) 141
BspLI GGNNCC 3 cut(s) 42, 115, 214
BspPI GGATC 1 cut(s) 494
BspT107I GGYRCC 1 cut(s) 113
BsrI ACTGG 2 cut(s) 258, 600
BssECI CCNNGG 2 cut(s) 354, 438
BssMI GATC 4 cut(s) 28, 174, 225, 486
BssT1I CCWWGG 1 cut(s) 354
Bst2UI CCWGG 3 cut(s) 184, 439, 720
Bst4CI ACNGT 1 cut(s) 148
Bst6I CTCTTC 1 cut(s) 12
BstBAI YACGTR 1 cut(s) 265
BstC8I GCNNGC 4 cut(s) 217, 246, 508, 589
BstDEI CTNAG 1 cut(s) 624
BstF5I GGATG 2 cut(s) 179, 640
BstKTI GATC 4 cut(s) 31, 177, 228, 489
BstMBI GATC 4 cut(s) 28, 174, 225, 486
BstMWI GCNNNNNNNGC 5 cut(s) 96, 245, 374, 434, 449
BstNI CCWGG 3 cut(s) 184, 439, 720
BstNSI RCATGY 1 cut(s) 617
BstSCI CCNGG 4 cut(s) 182, 348, 437, 718
BstSFI CTRYAG 1 cut(s) 234
BstV1I GCAGC 1 cut(s) 157
BstXI CCANNNNNNTGG 1 cut(s) 587
BsuRI GGCC 5 cut(s) 99, 353, 437, 510, 534
BtsCI GGATG 2 cut(s) 179, 640
Cac8I GCNNGC 4 cut(s) 217, 246, 508, 589
CciI TCATGA 1 cut(s) 141
Cfr13I GGNCC 2 cut(s) 509, 533
CviAII CATG 5 cut(s) 142, 339, 544, 581, 614
DdeI CTNAG 1 cut(s) 624
DpnI GATC 4 cut(s) 30, 176, 227, 488
DpnII GATC 4 cut(s) 28, 174, 225, 486
EaeI YGGCCR 1 cut(s) 97
Eam1104I CTCTTC 1 cut(s) 12
EarI CTCTTC 1 cut(s) 12
Eco130I CCWWGG 1 cut(s) 354
Eco24I GRGCYC 1 cut(s) 302
Eco88I CYCGRG 1 cut(s) 295
EcoRII CCWGG 3 cut(s) 182, 437, 718
EcoT14I CCWWGG 1 cut(s) 354
EcoT38I GRGCYC 1 cut(s) 302
ErhI CCWWGG 1 cut(s) 354
FaeI CATG 5 cut(s) 145, 342, 547, 584, 617
FalI AAGNNNNNCTT 2 cut(s) 9, 41
FaqI GGGAC 1 cut(s) 662
FatI CATG 5 cut(s) 141, 338, 543, 580, 613
FauI CCCGC 1 cut(s) 720
FauNDI CATATG 2 cut(s) 199, 679
FblI GTMKAC 1 cut(s) 496
Fnu4HI GCNGC 2 cut(s) 88, 171
FokI GGATG 2 cut(s) 166, 647
FriOI GRGCYC 1 cut(s) 302
Fsp4HI GCNGC 2 cut(s) 88, 171
FspBI CTAG 1 cut(s) 690
GluI GCNGC 2 cut(s) 88, 171
HaeIII GGCC 5 cut(s) 99, 353, 437, 510, 534
HapII CCGG 1 cut(s) 350
Hin1II CATG 5 cut(s) 145, 342, 547, 584, 617
HinfI GANTC 2 cut(s) 138, 360
HpaII CCGG 1 cut(s) 350
HphI GGTGA 1 cut(s) 142
Hpy166II GTNNAC 2 cut(s) 497, 605
Hpy188I TCNGA 3 cut(s) 45, 273, 491
Hpy188III TCNNGA 2 cut(s) 142, 623
Hpy8I GTNNAC 2 cut(s) 497, 605
HpyAV CCTTC 3 cut(s) 155, 264, 522
HpyCH4III ACNGT 1 cut(s) 148
HpyCH4IV ACGT 1 cut(s) 264
HpyCH4V TGCA 4 cut(s) 50, 248, 613, 665
HpyF10VI GCNNNNNNNGC 5 cut(s) 96, 245, 374, 434, 449
HpyF3I CTNAG 1 cut(s) 624
HpySE526I ACGT 1 cut(s) 264
Hsp92II CATG 5 cut(s) 145, 342, 547, 584, 617
Kzo9I GATC 4 cut(s) 28, 174, 225, 486
LmnI GCTCC 1 cut(s) 212
Lsp1109I GCAGC 1 cut(s) 157
LweI GCATC 3 cut(s) 12, 324, 696
MaeI CTAG 1 cut(s) 690
MaeII ACGT 1 cut(s) 264
MaeIII GTNAC 5 cut(s) 107, 260, 290, 641, 683
MalI GATC 4 cut(s) 30, 176, 227, 488
MboI GATC 4 cut(s) 28, 174, 225, 486
MboII GAAGA 5 cut(s) 23, 29, 466, 611, 683
MfeI CAATTG 1 cut(s) 608
MhlI GDGCHC 1 cut(s) 302
MlsI TGGCCA 1 cut(s) 99
MluCI AATT 4 cut(s) 63, 383, 608, 652
MluNI TGGCCA 1 cut(s) 99
MnlI CCTC 6 cut(s) 341, 356, 427, 565, 587, 726
Mox20I TGGCCA 1 cut(s) 99
MscI TGGCCA 1 cut(s) 99
MseI TTAA 3 cut(s) 8, 62, 221
MslI CAYNNNNRTG 2 cut(s) 119, 548
Msp20I TGGCCA 1 cut(s) 99
MspI CCGG 1 cut(s) 350
MspR9I CCNGG 4 cut(s) 184, 350, 439, 720
MunI CAATTG 1 cut(s) 608
MvaI CCWGG 3 cut(s) 184, 439, 720
MwoI GCNNNNNNNGC 5 cut(s) 96, 245, 374, 434, 449
NciI CCSGG 1 cut(s) 350
NdeI CATATG 2 cut(s) 199, 679
NdeII GATC 4 cut(s) 28, 174, 225, 486
NlaIII CATG 5 cut(s) 145, 342, 547, 584, 617
NlaIV GGNNCC 3 cut(s) 42, 115, 214
NmuCI GTSAC 3 cut(s) 107, 641, 683
NspI RCATGY 1 cut(s) 617
OliI CACNNNNGTG 1 cut(s) 119
PaeR7I CTCGAG 1 cut(s) 295
PagI TCATGA 1 cut(s) 141
PfeI GAWTC 2 cut(s) 138, 360
PfoI TCCNGGA 1 cut(s) 182
PkrI GCNGC 2 cut(s) 89, 172
Ppu21I YACGTR 1 cut(s) 265
PsiI TTATAA 1 cut(s) 458
Psp6I CCWGG 3 cut(s) 182, 437, 718
PspGI CCWGG 3 cut(s) 182, 437, 718
PspN4I GGNNCC 3 cut(s) 42, 115, 214
PspPI GGNCC 2 cut(s) 509, 533
PspXI VCTCGAGB 1 cut(s) 295
RseI CAYNNNNRTG 2 cut(s) 119, 548
SaqAI TTAA 3 cut(s) 8, 62, 221
SatI GCNGC 2 cut(s) 88, 171
Sau3AI GATC 4 cut(s) 28, 174, 225, 486
Sau96I GGNCC 2 cut(s) 509, 533
ScrFI CCNGG 4 cut(s) 184, 350, 439, 720
SduI GDGCHC 1 cut(s) 302
SetI ASST 4 cut(s) 166, 241, 267, 430
SfaNI GCATC 3 cut(s) 12, 324, 696
SfcI CTRYAG 1 cut(s) 234
Sfr274I CTCGAG 1 cut(s) 295
SlaI CTCGAG 1 cut(s) 295
SmiMI CAYNNNNRTG 2 cut(s) 119, 548
SmlI CTYRAG 1 cut(s) 295
SmoI CTYRAG 1 cut(s) 295
Sse9I AATT 4 cut(s) 63, 383, 608, 652
SsiI CCGC 2 cut(s) 87, 713
SspI AATATT 1 cut(s) 661
SspMI CTAG 1 cut(s) 690
StyD4I CCNGG 4 cut(s) 182, 348, 437, 718
StyI CCWWGG 1 cut(s) 354
TaaI ACNGT 1 cut(s) 148
TaiI ACGT 1 cut(s) 267
TaqI TCGA 1 cut(s) 296
TasI AATT 4 cut(s) 63, 383, 608, 652
TauI GCSGC 1 cut(s) 90
TfiI GAWTC 2 cut(s) 138, 360
Tru1I TTAA 3 cut(s) 8, 62, 221
Tru9I TTAA 3 cut(s) 8, 62, 221
TseFI GTSAC 3 cut(s) 107, 641, 683
TseI GCWGC 1 cut(s) 170
Tsp45I GTSAC 3 cut(s) 107, 641, 683
TspDTI ATGAA 1 cut(s) 651
TspGWI ACGGA 1 cut(s) 647
XceI RCATGY 1 cut(s) 617
XhoI CTCGAG 1 cut(s) 295
XmiI GTMKAC 1 cut(s) 496
XspI CTAG 1 cut(s) 690
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.