Rmu_co8205520.1_g000001

Bifunctional DNA N-glycosylase with associated apurinic apyrimidinic (AP) lyase function that catalyzes the first step in base excision repair (BER), the primary repair pathway for the repair of oxidative DNA damage. The DNA N-glycosylase activity releases the damaged DNA base from DNA by cleaving the N- glycosidic bond, leaving an AP site. The AP lyase activity cleaves the phosphodiester bond 3' to the AP site by a beta-elimination. Primarily recognizes and repairs oxidative base damage of pyrimidines

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co8205520.1
Physical Location & Seq
Reverse (-)
1 .. 718
718 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co8205520.1_g000001.1.cds

Sequence Viewer

Length: 335 bp
gagcaattcagcgtctccttcaaaatggtttgctctctgctgacgccattgacaaaggtgatgaagcaaccattaaaagcttgatttacccggttggcttttatacaagaaaggctagtaacttgaagaaaattgcaaaaatttgtcttgtcaagtacgatggagatatacctagctcattggaggaactcctctcacttccaggaataggtcctaagatggctcatttggttatgaatgtcgcttgggacaatgttcaagggatttgtgtagatacccatgtgcaccggatttgcaaccgccttggctgggtgtcaagggcaggcaaaaaacag

Protein Analysis

111

Amino Acids

12.2

Weight (kDa)

9.27

Isoelectric Point (pI)

23.7

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 300
AcsI RAATTY 1 cut(s) 140
AcyI GRCGYC 1 cut(s) 44
AfaI GTAC 1 cut(s) 157
AfiI CCNNNNNNNGG 2 cut(s) 208, 309
AgsI TTSAA 3 cut(s) 22, 126, 259
AjnI CCWGG 1 cut(s) 201
AluBI AGCT 2 cut(s) 80, 176
AluI AGCT 2 cut(s) 80, 176
Alw21I GWGCWC 1 cut(s) 287
Alw26I GTCTC 1 cut(s) 19
Alw44I GTGCAC 1 cut(s) 283
ApaLI GTGCAC 1 cut(s) 283
ApoI RAATTY 1 cut(s) 140
AspS9I GGNCC 1 cut(s) 211
AsuC2I CCSGG 1 cut(s) 91
AsuHPI GGTGA 1 cut(s) 70
AvaII GGWCC 1 cut(s) 211
BaeGI GKGCMC 1 cut(s) 287
BaeI ACNNNNGTAYC 2 cut(s) 266, 299
Bbv12I GWGCWC 1 cut(s) 287
BccI CCATC 2 cut(s) 154, 213
BciT130I CCWGG 1 cut(s) 203
BcnI CCSGG 1 cut(s) 91
BcoDI GTCTC 1 cut(s) 19
BfaI CTAG 2 cut(s) 116, 173
Bme1390I CCNGG 2 cut(s) 91, 203
Bme18I GGWCC 1 cut(s) 211
BmgT120I GGNCC 1 cut(s) 211
BmrFI CCNGG 2 cut(s) 91, 203
BpuMI CCSGG 1 cut(s) 91
BsaHI GRCGYC 1 cut(s) 44
BsaJI CCNNGG 1 cut(s) 303
BsaWI WCCGGW 1 cut(s) 287
Bsc4I CCNNNNNNNGG 2 cut(s) 208, 309
BseBI CCWGG 1 cut(s) 203
BseDI CCNNGG 1 cut(s) 303
BseLI CCNNNNNNNGG 2 cut(s) 208, 309
BseRI GAGGAG 1 cut(s) 181
BseSI GKGCMC 1 cut(s) 287
BseYI CCCAGC 1 cut(s) 308
BsiHKAI GWGCWC 1 cut(s) 287
BsiSI CCGG 2 cut(s) 91, 288
BslFI GGGAC 1 cut(s) 262
BslI CCNNNNNNNGG 2 cut(s) 208, 309
BsmAI GTCTC 1 cut(s) 19
BsmBI CGTCTC 1 cut(s) 19
BsmFI GGGAC 1 cut(s) 262
Bsp1286I GDGCHC 1 cut(s) 287
BspACI CCGC 1 cut(s) 300
BssECI CCNNGG 1 cut(s) 303
BssNI GRCGYC 1 cut(s) 44
BssT1I CCWWGG 1 cut(s) 303
Bst2UI CCWGG 1 cut(s) 203
BstACI GRCGYC 1 cut(s) 44
BstC8I GCNNGC 1 cut(s) 324
BstDEI CTNAG 1 cut(s) 215
BstMAI GTCTC 1 cut(s) 19
BstNI CCWGG 1 cut(s) 203
BstSCI CCNGG 2 cut(s) 89, 201
BstSLI GKGCMC 1 cut(s) 287
Cac8I GCNNGC 1 cut(s) 324
Cfr13I GGNCC 1 cut(s) 211
CseI GACGC 1 cut(s) 52
Csp6I GTAC 1 cut(s) 156
CviAII CATG 1 cut(s) 280
CviJI RGCY 6 cut(s) 80, 98, 115, 176, 223, 308
CviKI_1 RGCY 6 cut(s) 80, 98, 115, 176, 223, 308
CviQI GTAC 1 cut(s) 156
DdeI CTNAG 1 cut(s) 215
Eco130I CCWWGG 1 cut(s) 303
Eco47I GGWCC 1 cut(s) 211
EcoO109I RGGNCCY 1 cut(s) 211
EcoRII CCWGG 1 cut(s) 201
EcoT14I CCWWGG 1 cut(s) 303
ErhI CCWWGG 1 cut(s) 303
Esp3I CGTCTC 1 cut(s) 19
FaeI CATG 1 cut(s) 283
FaiI YATR 4 cut(s) 104, 169, 235, 281
FaqI GGGAC 1 cut(s) 262
FatI CATG 1 cut(s) 279
FspBI CTAG 2 cut(s) 116, 173
GsaI CCCAGC 1 cut(s) 312
HapII CCGG 2 cut(s) 91, 288
HgaI GACGC 1 cut(s) 52
Hin1I GRCGYC 1 cut(s) 44
Hin1II CATG 1 cut(s) 283
HindIII AAGCTT 1 cut(s) 78
HpaII CCGG 2 cut(s) 91, 288
HphI GGTGA 1 cut(s) 70
Hpy166II GTNNAC 1 cut(s) 285
Hpy8I GTNNAC 1 cut(s) 285
HpyAV CCTTC 1 cut(s) 28
HpyCH4V TGCA 3 cut(s) 136, 285, 296
HpyF3I CTNAG 1 cut(s) 215
Hsp92I GRCGYC 1 cut(s) 44
Hsp92II CATG 1 cut(s) 283
LpnPI CCDG 6 cut(s) 104, 188, 215, 294, 301, 308
MaeI CTAG 2 cut(s) 116, 173
MaeIII GTNAC 1 cut(s) 118
MboII GAAGA 1 cut(s) 138
MhlI GDGCHC 1 cut(s) 287
MluCI AATT 3 cut(s) 5, 131, 140
MnlI CCTC 2 cut(s) 177, 202
MseI TTAA 1 cut(s) 74
MspI CCGG 2 cut(s) 91, 288
MspR9I CCNGG 2 cut(s) 91, 203
MvaI CCWGG 1 cut(s) 203
NciI CCSGG 1 cut(s) 91
NlaIII CATG 1 cut(s) 283
PfoI TCCNGGA 1 cut(s) 201
PpuMI RGGWCCY 1 cut(s) 211
Psp5II RGGWCCY 1 cut(s) 211
Psp6I CCWGG 1 cut(s) 201
PspFI CCCAGC 1 cut(s) 308
PspGI CCWGG 1 cut(s) 201
PspPI GGNCC 1 cut(s) 211
PspPPI RGGWCCY 1 cut(s) 211
RsaI GTAC 1 cut(s) 157
RsaNI GTAC 1 cut(s) 156
SaqAI TTAA 1 cut(s) 74
Sau96I GGNCC 1 cut(s) 211
ScrFI CCNGG 2 cut(s) 91, 203
SduI GDGCHC 1 cut(s) 287
SetI ASST 5 cut(s) 60, 82, 174, 178, 213
SinI GGWCC 1 cut(s) 211
Sse9I AATT 3 cut(s) 5, 131, 140
SsiI CCGC 1 cut(s) 300
SspMI CTAG 2 cut(s) 116, 173
StyD4I CCNGG 2 cut(s) 89, 201
StyI CCWWGG 1 cut(s) 303
TasI AATT 3 cut(s) 5, 131, 140
Tru1I TTAA 1 cut(s) 74
Tru9I TTAA 1 cut(s) 74
TspDTI ATGAA 2 cut(s) 77, 250
VneI GTGCAC 1 cut(s) 283
VpaK11BI GGWCC 1 cut(s) 211
XapI RAATTY 1 cut(s) 140
XspI CTAG 2 cut(s) 116, 173
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.