Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_co8226669.1

Orthogroup ID

OG0005455

Physical Location & Seq

Genomic Coordinates Forward (+)

1 .. 749

Gene Structure 749 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_co8226669.1_g000001.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 349 bp

tggaaatttggaactgtcagaaaaatgtttccaggaattgatcctcaaagatcaaaatcatcccaccgccttgatcaattatgctgcccttcttttatgtagatatggttcagttgttgcaggtgctggggcaaatgctggtggaggtgcttctgcagatcacatttctgctatcaatgttgcaaaggagtgtctgttagcatccttgaatgaagatcctaaagcaggacatatctgggctaatcttgcaaatgcctattatatgaccggtgatcatagaagttccagcaagtgcttggagaaggtgcttatggctcattgctacatttatttattgcttatttactga

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0000288 GO:0000291 GO:0000785 GO:0000956 GO:0005575 GO:0005622 GO:0005623 GO:0005634 GO:0005654 GO:0005694 GO:0005737 GO:0005829 GO:0006139 GO:0006401 GO:0006402 GO:0006725 GO:0006807 GO:0008150 GO:0008152 GO:0009056 GO:0009057 GO:0009892 GO:0009987 GO:0010468 GO:0010605 GO:0010629 GO:0016070 GO:0016071 GO:0019222 GO:0019439 GO:0031974 GO:0031981 GO:0032991 GO:0034641 GO:0034655 GO:0035327 GO:0043170 GO:0043226 GO:0043227 GO:0043228 GO:0043229 GO:0043231 GO:0043232 GO:0043233 GO:0043928 GO:0044237 GO:0044238 GO:0044248 GO:0044260 GO:0044265 GO:0044270 GO:0044422 GO:0044424 GO:0044427 GO:0044428 GO:0044444 GO:0044446 GO:0044464 GO:0046483 GO:0046700 GO:0048519 GO:0050789 GO:0055087 GO:0060255 GO:0065007 GO:0070013 GO:0071704 GO:0090304 GO:1901360 GO:1901361 GO:1901575

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

TPR_1 TPR_16 TPR_19 TPR_2 TPR_7 TPR_8

Protein Analysis

115

Amino Acids

12.37

Weight (kDa)

6.19

Isoelectric Point (pI)

38.92

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0005455)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT5G63200 AT5G63200
fragaria_vesca	FvH4_5g07030 FvH4_5g07030 FvH4_5g07030 FvH4_5g07030 FvH4_5g07030 FvH4_5g07030 FvH4_5g07030
malus_domestica	MD06G1160400.v1.1
prunus_persica	Prupe.5G160000_v2.0.a1
pyrus_communis	pycom06g14350
rosa_chinensis	RchiOBHm_Chr5g0027621 RchiOBHm_Chr5g0027631 RchiOBHm_Chr7g0191501
rosa_laevigata	RLG00000004443
rosa_multiflora	Rmu_co8226669.1_g000001 Rmu_sc0002661.1_g000013 Rmu_sc0010599.1_g000002
rosa_roxburghii	Rroxscaffold_157G00438440 Rroxscaffold_3G00263740
rosa_rugosa	Rorug05G0100300 Rorug06G0510500
rosa_samantha	Rh5CG212600 Rh5DG194500 Rh7AG118900 Rh7BG121000 Rh7CG123700 Rh7DG121800

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AarI	CACCTGC	1 cut(s)	111
Acc36I	ACCTGC	1 cut(s)	111
AciI	CCGC	1 cut(s)	67
AclWI	GGATC	2 cut(s)	35, 210
AcsI	RAATTY	1 cut(s)	5
AfiI	CCNNNNNNNGG	1 cut(s)	225
AgeI	ACCGGT	1 cut(s)	267
AgsI	TTSAA	1 cut(s)	209
AjnI	CCWGG	1 cut(s)	31
AlwI	GGATC	2 cut(s)	35, 210
AlwNI	CAGNNNCTG	1 cut(s)	126
ApeKI	GCWGC	1 cut(s)	84
ApoI	RAATTY	1 cut(s)	5
AsiGI	ACCGGT	1 cut(s)	267
AsuHPI	GGTGA	1 cut(s)	282
BbvI	GCAGC	1 cut(s)	71
BciT130I	CCWGG	1 cut(s)	33
BclI	TGATCA	2 cut(s)	73, 272
BfmI	CTRYAG	1 cut(s)	154
BfuAI	ACCTGC	1 cut(s)	111
BisI	GCNGC	1 cut(s)	85
BlsI	GCNGC	1 cut(s)	86
Bme1390I	CCNGG	1 cut(s)	33
BmrFI	CCNGG	1 cut(s)	33
BmsI	GCATC	1 cut(s)	210
BsaBI	GATNNNNATC	1 cut(s)	55
BsaWI	WCCGGW	1 cut(s)	267
BsaXI	ACNNNNNCTCC	2 cut(s)	180, 210
Bsc4I	CCNNNNNNNGG	1 cut(s)	225
Bse118I	RCCGGY	1 cut(s)	267
Bse3DI	GCAATG	1 cut(s)	317
Bse8I	GATNNNNATC	1 cut(s)	55
BseBI	CCWGG	1 cut(s)	33
BseGI	GGATG	2 cut(s)	59, 201
BseJI	GATNNNNATC	1 cut(s)	55
BseLI	CCNNNNNNNGG	1 cut(s)	225
BseMI	GCAATG	1 cut(s)	317
BseXI	GCAGC	1 cut(s)	71
BseYI	CCCAGC	1 cut(s)	126
BshTI	ACCGGT	1 cut(s)	267
BsiSI	CCGG	1 cut(s)	268
BslI	CCNNNNNNNGG	1 cut(s)	225
Bsp143I	GATC	6 cut(s)	40, 50, 73, 158, 215, 272
BspACI	CCGC	1 cut(s)	67
BspMAI	CTGCAG	1 cut(s)	158
BspMI	ACCTGC	1 cut(s)	111
BspPI	GGATC	2 cut(s)	35, 210
BsrDI	GCAATG	1 cut(s)	317
BsrFI	RCCGGY	1 cut(s)	267
BssAI	RCCGGY	1 cut(s)	267
BssMI	GATC	6 cut(s)	40, 50, 73, 158, 215, 272
Bst2UI	CCWGG	1 cut(s)	33
Bst4CI	ACNGT	1 cut(s)	16
BstENI	CCTNNNNNAGG	1 cut(s)	223
BstF5I	GGATG	2 cut(s)	59, 201
BstKTI	GATC	6 cut(s)	43, 53, 76, 161, 218, 275
BstMBI	GATC	6 cut(s)	40, 50, 73, 158, 215, 272
BstMWI	GCNNNNNNNGC	1 cut(s)	246
BstNI	CCWGG	1 cut(s)	33
BstSCI	CCNGG	1 cut(s)	31
BstSFI	CTRYAG	1 cut(s)	154
BstV1I	GCAGC	1 cut(s)	71
BstX2I	RGATCY	1 cut(s)	215
BstYI	RGATCY	1 cut(s)	215
BtsCI	GGATG	2 cut(s)	59, 201
BveI	ACCTGC	1 cut(s)	111
CaiI	CAGNNNCTG	1 cut(s)	126
Cfr10I	RCCGGY	1 cut(s)	267
CspAI	ACCGGT	1 cut(s)	267
CviJI	RGCY	2 cut(s)	240, 315
CviKI_1	RGCY	2 cut(s)	240, 315
DpnI	GATC	6 cut(s)	42, 52, 75, 160, 217, 274
DpnII	GATC	6 cut(s)	40, 50, 73, 158, 215, 272
EcoNI	CCTNNNNNAGG	1 cut(s)	223
EcoRII	CCWGG	1 cut(s)	31
FaiI	YATR	8 cut(s)	82, 98, 106, 232, 262, 264, 277, 312
FbaI	TGATCA	2 cut(s)	73, 272
Fnu4HI	GCNGC	1 cut(s)	85
FokI	GGATG	2 cut(s)	46, 188
Fsp4HI	GCNGC	1 cut(s)	85
GluI	GCNGC	1 cut(s)	85
GsaI	CCCAGC	1 cut(s)	130
HapII	CCGG	1 cut(s)	268
HpaII	CCGG	1 cut(s)	268
HphI	GGTGA	1 cut(s)	282
Hpy188I	TCNGA	1 cut(s)	20
HpyAV	CCTTC	2 cut(s)	99, 296
HpyCH4III	ACNGT	1 cut(s)	16
HpyCH4V	TGCA	4 cut(s)	120, 156, 183, 249
HpyF10VI	GCNNNNNNNGC	1 cut(s)	246
Ksp22I	TGATCA	2 cut(s)	73, 272
Kzo9I	GATC	6 cut(s)	40, 50, 73, 158, 215, 272
LpnPI	CCDG	9 cut(s)	18, 45, 106, 112, 124, 211, 221, 281, 299
Lsp1109I	GCAGC	1 cut(s)	71
LweI	GCATC	1 cut(s)	210
MalI	GATC	6 cut(s)	42, 52, 75, 160, 217, 274
MboI	GATC	6 cut(s)	40, 50, 73, 158, 215, 272
MboII	GAAGA	1 cut(s)	225
MflI	RGATCY	1 cut(s)	215
MluCI	AATT	3 cut(s)	5, 36, 77
MnlI	CCTC	2 cut(s)	54, 138
MspI	CCGG	1 cut(s)	268
MspR9I	CCNGG	1 cut(s)	33
MvaI	CCWGG	1 cut(s)	33
MwoI	GCNNNNNNNGC	1 cut(s)	246
NdeII	GATC	6 cut(s)	40, 50, 73, 158, 215, 272
PaqCI	CACCTGC	1 cut(s)	111
PfoI	TCCNGGA	1 cut(s)	31
PinAI	ACCGGT	1 cut(s)	267
PkrI	GCNGC	1 cut(s)	86
Psp6I	CCWGG	1 cut(s)	31
PspFI	CCCAGC	1 cut(s)	126
PspGI	CCWGG	1 cut(s)	31
PsrI	GAACNNNNNNTAC	2 cut(s)	92, 124
PstI	CTGCAG	1 cut(s)	158
PstNI	CAGNNNCTG	1 cut(s)	126
PsuI	RGATCY	1 cut(s)	215
SatI	GCNGC	1 cut(s)	85
Sau3AI	GATC	6 cut(s)	40, 50, 73, 158, 215, 272
ScrFI	CCNGG	1 cut(s)	33
SetI	ASST	3 cut(s)	125, 149, 307
SfaNI	GCATC	1 cut(s)	210
SfcI	CTRYAG	1 cut(s)	154
Sse9I	AATT	3 cut(s)	5, 36, 77
SsiI	CCGC	1 cut(s)	67
StyD4I	CCNGG	1 cut(s)	31
TaaI	ACNGT	1 cut(s)	16
TasI	AATT	3 cut(s)	5, 36, 77
TseI	GCWGC	1 cut(s)	84
TspDTI	ATGAA	1 cut(s)	226
XagI	CCTNNNNNAGG	1 cut(s)	223
XapI	RAATTY	1 cut(s)	5
XcmI	CCANNNNNNNNNTGG	1 cut(s)	293

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.