Rh5CG212600

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr5C
OG0005455
Physical Location & Seq
Forward (+)
21519603 .. 21520135
533 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh5CG212600.1

Sequence Viewer

Length: 387 bp
ATGCCTCCATTGCCTCCTCTTGATAGCCCTTTACCGCGACAGCAACCCTATACTGGGCCACTTATTTTTCCCCCCAAAACTGTTAAGTATGTTAGCACAGATTTACTAGTCAAACAATTTATTTTGATGCTAGCAATGAAATTTGAAGCACACCCTCGCTCCTCGTATTTGCTATATGTACTTGGAGGCTCGATTCTGCTTTATCTCCTTTCTTTTTTCATAATACCTGATGCACCTCCCGATGCTCCTTCTGGTGGACCTTTTGGTGGACCTTTGGGTGGGCCTCATGGTGGAGCTCCTAGTGGACCTGCTGATGGTCATGCTGATGATGGTCCTCCCAATGGAGGTAAAAATTCTGTCATTGCTGTTTCTTCTTACTTGAAATAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

128

Amino Acids

13.39

Weight (kDa)

6.81

Isoelectric Point (pI)

51.32

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc36I ACCTGC 1 cut(s) 316
AccII CGCG 1 cut(s) 37
AciI CCGC 1 cut(s) 35
AcsI RAATTY 2 cut(s) 140, 352
AfaI GTAC 1 cut(s) 180
AfiI CCNNNNNNNGG 9 cut(s) 53, 54, 254, 266, 278, 290, 314, 341, 344
AgsI TTSAA 2 cut(s) 146, 382
AhlI ACTAGT 1 cut(s) 106
AluBI AGCT 1 cut(s) 296
AluI AGCT 1 cut(s) 296
Alw21I GWGCWC 1 cut(s) 298
AoxI GGCC 2 cut(s) 56, 281
ApoI RAATTY 2 cut(s) 140, 352
AspS9I GGNCC 6 cut(s) 56, 257, 269, 281, 305, 332
AsuNHI GCTAGC 1 cut(s) 130
AvaII GGWCC 4 cut(s) 257, 269, 305, 332
BanII GRGCYC 1 cut(s) 298
Bbv12I GWGCWC 1 cut(s) 298
BccI CCATC 2 cut(s) 308, 323
BcuI ACTAGT 1 cut(s) 106
BfaI CTAG 3 cut(s) 107, 131, 300
BfuAI ACCTGC 1 cut(s) 316
Bme18I GGWCC 4 cut(s) 257, 269, 305, 332
BmgT120I GGNCC 6 cut(s) 56, 257, 269, 281, 305, 332
BmrI ACTGGG 1 cut(s) 63
BmsI GCATC 3 cut(s) 117, 220, 232
BmtI GCTAGC 1 cut(s) 134
BmuI ACTGGG 1 cut(s) 63
BsaXI ACNNNNNCTCC 2 cut(s) 143, 173
Bsc4I CCNNNNNNNGG 9 cut(s) 53, 54, 254, 266, 278, 290, 314, 341, 344
Bse1I ACTGG 1 cut(s) 58
Bse3DI GCAATG 3 cut(s) 8, 141, 360
BseLI CCNNNNNNNGG 9 cut(s) 53, 54, 254, 266, 278, 290, 314, 341, 344
BseMI GCAATG 3 cut(s) 8, 141, 360
BseNI ACTGG 1 cut(s) 58
BseRI GAGGAG 2 cut(s) 6, 151
Bsh1236I CGCG 1 cut(s) 37
BshFI GGCC 2 cut(s) 58, 283
BsiHKAI GWGCWC 1 cut(s) 298
BslI CCNNNNNNNGG 9 cut(s) 53, 54, 254, 266, 278, 290, 314, 341, 344
BsnI GGCC 2 cut(s) 58, 283
Bsp1286I GDGCHC 1 cut(s) 298
BspACI CCGC 1 cut(s) 35
BspANI GGCC 2 cut(s) 58, 283
BspFNI CGCG 1 cut(s) 37
BspMI ACCTGC 1 cut(s) 316
BspOI GCTAGC 1 cut(s) 134
BsrDI GCAATG 3 cut(s) 8, 141, 360
BsrI ACTGG 1 cut(s) 58
Bst4CI ACNGT 1 cut(s) 82
BstC8I GCNNGC 1 cut(s) 132
BstFNI CGCG 1 cut(s) 37
BstMWI GCNNNNNNNGC 1 cut(s) 10
BstUI CGCG 1 cut(s) 37
BsuRI GGCC 2 cut(s) 58, 283
BveI ACCTGC 1 cut(s) 316
Cac8I GCNNGC 1 cut(s) 132
Cfr13I GGNCC 6 cut(s) 56, 257, 269, 281, 305, 332
Csp6I GTAC 1 cut(s) 179
CviAII CATG 2 cut(s) 287, 320
CviJI RGCY 5 cut(s) 27, 58, 189, 283, 296
CviKI_1 RGCY 5 cut(s) 27, 58, 189, 283, 296
CviQI GTAC 1 cut(s) 179
Ecl136II GAGCTC 1 cut(s) 296
Eco24I GRGCYC 1 cut(s) 298
Eco47I GGWCC 4 cut(s) 257, 269, 305, 332
Eco53kI GAGCTC 1 cut(s) 296
EcoICRI GAGCTC 1 cut(s) 296
EcoT38I GRGCYC 1 cut(s) 298
FaeI CATG 2 cut(s) 290, 323
FaiI YATR 7 cut(s) 51, 90, 175, 177, 221, 288, 321
FatI CATG 2 cut(s) 286, 319
FriOI GRGCYC 1 cut(s) 298
FspBI CTAG 3 cut(s) 107, 131, 300
HaeIII GGCC 2 cut(s) 58, 283
Hin1II CATG 2 cut(s) 290, 323
HinfI GANTC 1 cut(s) 193
Hpy166II GTNNAC 3 cut(s) 257, 269, 305
Hpy188III TCNNGA 2 cut(s) 20, 239
Hpy8I GTNNAC 3 cut(s) 257, 269, 305
HpyAV CCTTC 1 cut(s) 258
HpyCH4III ACNGT 1 cut(s) 82
HpyCH4V TGCA 1 cut(s) 233
HpyF10VI GCNNNNNNNGC 1 cut(s) 10
Hsp92II CATG 2 cut(s) 290, 323
LmnI GCTCC 4 cut(s) 164, 250, 293, 301
LpnPI CCDG 4 cut(s) 39, 237, 240, 321
LweI GCATC 3 cut(s) 117, 220, 232
MaeI CTAG 3 cut(s) 107, 131, 300
MboII GAAGA 1 cut(s) 363
MhlI GDGCHC 1 cut(s) 298
MluCI AATT 3 cut(s) 116, 140, 352
MseI TTAA 1 cut(s) 84
MslI CAYNNNNRTG 1 cut(s) 324
MvnI CGCG 1 cut(s) 37
MwoI GCNNNNNNNGC 1 cut(s) 10
NheI GCTAGC 1 cut(s) 130
NlaIII CATG 2 cut(s) 290, 323
PfeI GAWTC 1 cut(s) 193
Psp124BI GAGCTC 1 cut(s) 298
PspPI GGNCC 6 cut(s) 56, 257, 269, 281, 305, 332
RsaI GTAC 1 cut(s) 180
RsaNI GTAC 1 cut(s) 179
RseI CAYNNNNRTG 1 cut(s) 324
SacI GAGCTC 1 cut(s) 298
SaqAI TTAA 1 cut(s) 84
Sau96I GGNCC 6 cut(s) 56, 257, 269, 281, 305, 332
SduI GDGCHC 1 cut(s) 298
SetI ASST 7 cut(s) 229, 238, 262, 274, 298, 310, 349
SfaNI GCATC 3 cut(s) 117, 220, 232
SinI GGWCC 4 cut(s) 257, 269, 305, 332
SmiMI CAYNNNNRTG 1 cut(s) 324
SpeI ACTAGT 1 cut(s) 106
Sse9I AATT 3 cut(s) 116, 140, 352
SsiI CCGC 1 cut(s) 35
SspMI CTAG 3 cut(s) 107, 131, 300
SstI GAGCTC 1 cut(s) 298
TaaI ACNGT 1 cut(s) 82
TaqI TCGA 1 cut(s) 191
TasI AATT 3 cut(s) 116, 140, 352
TatI WGTACW 1 cut(s) 178
TfiI GAWTC 1 cut(s) 193
Tru1I TTAA 1 cut(s) 84
Tru9I TTAA 1 cut(s) 84
TspDTI ATGAA 2 cut(s) 152, 208
VpaK11BI GGWCC 4 cut(s) 257, 269, 305, 332
XapI RAATTY 2 cut(s) 140, 352
XspI CTAG 3 cut(s) 107, 131, 300
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.