Rmu_co8232297.1_g000001

Potassium channel

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co8232297.1
Physical Location & Seq
Forward (+)
70 .. 756
687 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co8232297.1_g000001.1.cds

Sequence Viewer

Length: 687 bp
atgcttgacaattgtcctggaggaggacagagaggaggatgcaaagatagctcacatgaagatgcagcaatgcaggaagcaaggaacaattgctttacagcttcgcaggctaggatgaagagtgaaataggcaaagctcaaatgacaggtgagaatggccaaactgaaattcaagctgcggtttgccagggccatctggaaaaggtaaaaattgtggttgaaggaggagcagatgtcaacaaaccggaagctagaggatggatgccgaaaggtctagcacaacagcaaggagacaaggacatacatgacctcttattaagttatgaaaatagaagagaaatggatgaacatagaatagagttcattgagccagaaacatctggaagcaccagcaattgtgaaggaatttgtaaaacacaggaagaccaccaacatattcattctcacttgagaaaggtagccatgaagacatatcagtgcccgtctagccctgcaagtgacagagaacaaaggatcagatcatacagcaagagagtaactatccacatgcattctaaaagtgaaagtgtgtcggaaaggcagcttgcgaaattaataattctacctaattccatagacgagctgctcagagttgctagtaagctttctttgtttaacctcagaaacatcactttgagacaaacctga

Protein Analysis

228

Amino Acids

25.52

Weight (kDa)

7.14

Isoelectric Point (pI)

54.88

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 179
AclWI GGATC 1 cut(s) 521
AcoI YGGCCR 1 cut(s) 157
AcsI RAATTY 2 cut(s) 168, 405
AfiI CCNNNNNNNGG 1 cut(s) 23
AgsI TTSAA 2 cut(s) 173, 221
AjnI CCWGG 2 cut(s) 16, 186
AjuI GAANNNNNNNTTGG 2 cut(s) 153, 185
AluBI AGCT 8 cut(s) 51, 101, 137, 176, 251, 583, 622, 643
AluI AGCT 8 cut(s) 51, 101, 137, 176, 251, 583, 622, 643
Alw26I GTCTC 2 cut(s) 285, 670
AlwI GGATC 1 cut(s) 521
AoxI GGCC 2 cut(s) 157, 190
ApeKI GCWGC 4 cut(s) 65, 176, 580, 622
ApoI RAATTY 2 cut(s) 168, 405
AseI ATTAAT 1 cut(s) 593
AspS9I GGNCC 1 cut(s) 190
AsuHPI GGTGA 1 cut(s) 161
BaeGI GKGCMC 1 cut(s) 482
BalI TGGCCA 1 cut(s) 159
BbsI GAAGAC 2 cut(s) 429, 473
BbvI GCAGC 4 cut(s) 77, 163, 592, 609
BccI CCATC 2 cut(s) 201, 252
BciT130I CCWGG 2 cut(s) 18, 188
BcoDI GTCTC 2 cut(s) 285, 670
BfaI CTAG 5 cut(s) 111, 252, 275, 486, 636
BisI GCNGC 4 cut(s) 66, 177, 581, 623
BlsI GCNGC 4 cut(s) 67, 178, 582, 624
Bme1390I CCNGG 2 cut(s) 18, 188
BmgT120I GGNCC 1 cut(s) 190
BmrFI CCNGG 2 cut(s) 18, 188
BmsI GCATC 3 cut(s) 29, 52, 252
BoxI GACNNNNGTC 1 cut(s) 12
BpiI GAAGAC 2 cut(s) 429, 473
BpmI CTGGAG 1 cut(s) 39
BpuEI CTTGAG 1 cut(s) 469
BsaJI CCNNGG 1 cut(s) 187
BsaWI WCCGGW 1 cut(s) 244
BsaXI ACNNNNNCTCC 2 cut(s) 219, 249
Bsc4I CCNNNNNNNGG 1 cut(s) 23
Bse3DI GCAATG 1 cut(s) 75
BseBI CCWGG 2 cut(s) 18, 188
BseDI CCNNGG 1 cut(s) 187
BseGI GGATG 5 cut(s) 44, 120, 263, 267, 349
BseLI CCNNNNNNNGG 1 cut(s) 23
BseMI GCAATG 1 cut(s) 75
BseMII CTCAG 2 cut(s) 640, 673
BseRI GAGGAG 3 cut(s) 36, 48, 240
BseSI GKGCMC 1 cut(s) 482
BseXI GCAGC 4 cut(s) 77, 163, 592, 609
BshFI GGCC 2 cut(s) 159, 192
BsiSI CCGG 1 cut(s) 245
BslI CCNNNNNNNGG 1 cut(s) 23
BsmAI GTCTC 2 cut(s) 285, 670
BsmI GAATGC 1 cut(s) 550
BsnI GGCC 2 cut(s) 159, 192
Bsp1286I GDGCHC 1 cut(s) 482
Bsp143I GATC 2 cut(s) 513, 518
BspACI CCGC 1 cut(s) 179
BspANI GGCC 2 cut(s) 159, 192
BspCNI CTCAG 2 cut(s) 639, 672
BspPI GGATC 1 cut(s) 521
BsrDI GCAATG 1 cut(s) 75
BssECI CCNNGG 1 cut(s) 187
BssMI GATC 2 cut(s) 513, 518
Bst2UI CCWGG 2 cut(s) 18, 188
Bst6I CTCTTC 2 cut(s) 113, 328
BstC8I GCNNGC 2 cut(s) 108, 585
BstDEI CTNAG 2 cut(s) 626, 659
BstENI CCTNNNNNAGG 1 cut(s) 21
BstF5I GGATG 5 cut(s) 44, 120, 263, 267, 349
BstKTI GATC 2 cut(s) 516, 521
BstMAI GTCTC 2 cut(s) 285, 670
BstMBI GATC 2 cut(s) 513, 518
BstMWI GCNNNNNNNGC 3 cut(s) 48, 107, 486
BstNI CCWGG 2 cut(s) 18, 188
BstNSI RCATGY 1 cut(s) 550
BstPAI GACNNNNGTC 1 cut(s) 12
BstSCI CCNGG 2 cut(s) 16, 186
BstSLI GKGCMC 1 cut(s) 482
BstV1I GCAGC 4 cut(s) 77, 163, 592, 609
BstV2I GAAGAC 2 cut(s) 429, 473
BsuRI GGCC 2 cut(s) 159, 192
BtsCI GGATG 5 cut(s) 44, 120, 263, 267, 349
BtsIMutI CAGTG 1 cut(s) 482
Cac8I GCNNGC 2 cut(s) 108, 585
Cfr13I GGNCC 1 cut(s) 190
CviAII CATG 4 cut(s) 56, 305, 463, 547
DdeI CTNAG 2 cut(s) 626, 659
DpnI GATC 2 cut(s) 515, 520
DpnII GATC 2 cut(s) 513, 518
EaeI YGGCCR 1 cut(s) 157
Eam1104I CTCTTC 2 cut(s) 113, 328
EarI CTCTTC 2 cut(s) 113, 328
EcoNI CCTNNNNNAGG 1 cut(s) 21
EcoRII CCWGG 2 cut(s) 16, 186
EcoT22I ATGCAT 1 cut(s) 552
FaeI CATG 4 cut(s) 59, 308, 466, 550
FatI CATG 4 cut(s) 55, 304, 462, 546
Fnu4HI GCNGC 4 cut(s) 66, 177, 581, 623
FokI GGATG 5 cut(s) 51, 127, 270, 274, 356
Fsp4HI GCNGC 4 cut(s) 66, 177, 581, 623
FspBI CTAG 5 cut(s) 111, 252, 275, 486, 636
GluI GCNGC 4 cut(s) 66, 177, 581, 623
GsuI CTGGAG 1 cut(s) 39
HaeIII GGCC 2 cut(s) 159, 192
HapII CCGG 1 cut(s) 245
Hin1II CATG 4 cut(s) 59, 308, 466, 550
HincII GTYRAC 1 cut(s) 238
HindII GTYRAC 1 cut(s) 238
HindIII AAGCTT 1 cut(s) 641
HpaII CCGG 1 cut(s) 245
HphI GGTGA 1 cut(s) 161
Hpy166II GTNNAC 1 cut(s) 238
Hpy188I TCNGA 4 cut(s) 518, 574, 629, 662
Hpy188III TCNNGA 2 cut(s) 197, 381
Hpy8I GTNNAC 1 cut(s) 238
HpyAV CCTTC 2 cut(s) 215, 395
HpyCH4V TGCA 5 cut(s) 42, 65, 73, 494, 550
HpyF10VI GCNNNNNNNGC 3 cut(s) 48, 107, 486
HpyF3I CTNAG 2 cut(s) 626, 659
Hsp92II CATG 4 cut(s) 59, 308, 466, 550
Kzo9I GATC 2 cut(s) 513, 518
LmnI GCTCC 1 cut(s) 227
Lsp1109I GCAGC 4 cut(s) 77, 163, 592, 609
LweI GCATC 3 cut(s) 29, 52, 252
MaeI CTAG 5 cut(s) 111, 252, 275, 486, 636
MaeIII GTNAC 2 cut(s) 497, 535
MalI GATC 2 cut(s) 515, 520
MboI GATC 2 cut(s) 513, 518
MboII GAAGA 5 cut(s) 71, 130, 345, 434, 478
MfeI CAATTG 3 cut(s) 10, 88, 394
MhlI GDGCHC 1 cut(s) 482
MlsI TGGCCA 1 cut(s) 159
MluCI AATT 9 cut(s) 10, 88, 168, 210, 394, 405, 590, 597, 607
MluNI TGGCCA 1 cut(s) 159
MmeI TCCRAC 1 cut(s) 552
MnlI CCTC 8 cut(s) 14, 17, 26, 29, 218, 248, 320, 668
Mox20I TGGCCA 1 cut(s) 159
Mph1103I ATGCAT 1 cut(s) 552
MscI TGGCCA 1 cut(s) 159
MseI TTAA 3 cut(s) 317, 593, 654
MslI CAYNNNNRTG 2 cut(s) 60, 475
Msp20I TGGCCA 1 cut(s) 159
MspI CCGG 1 cut(s) 245
MspR9I CCNGG 2 cut(s) 18, 188
MunI CAATTG 3 cut(s) 10, 88, 394
Mva1269I GAATGC 1 cut(s) 550
MvaI CCWGG 2 cut(s) 18, 188
MwoI GCNNNNNNNGC 3 cut(s) 48, 107, 486
NdeII GATC 2 cut(s) 513, 518
NlaIII CATG 4 cut(s) 59, 308, 466, 550
NmuCI GTSAC 1 cut(s) 497
NsiI ATGCAT 1 cut(s) 552
NspI RCATGY 1 cut(s) 550
PctI GAATGC 1 cut(s) 550
PfoI TCCNGGA 1 cut(s) 16
PkrI GCNGC 4 cut(s) 67, 178, 582, 624
PshAI GACNNNNGTC 1 cut(s) 12
PshBI ATTAAT 1 cut(s) 593
Psp6I CCWGG 2 cut(s) 16, 186
PspGI CCWGG 2 cut(s) 16, 186
PspPI GGNCC 1 cut(s) 190
RseI CAYNNNNRTG 2 cut(s) 60, 475
SaqAI TTAA 3 cut(s) 317, 593, 654
SatI GCNGC 4 cut(s) 66, 177, 581, 623
Sau3AI GATC 2 cut(s) 513, 518
Sau96I GGNCC 1 cut(s) 190
ScrFI CCNGG 2 cut(s) 18, 188
SduI GDGCHC 1 cut(s) 482
SfaNI GCATC 3 cut(s) 29, 52, 252
SmiMI CAYNNNNRTG 2 cut(s) 60, 475
SmlI CTYRAG 1 cut(s) 448
SmoI CTYRAG 1 cut(s) 448
Sse9I AATT 9 cut(s) 10, 88, 168, 210, 394, 405, 590, 597, 607
SsiI CCGC 1 cut(s) 179
SspMI CTAG 5 cut(s) 111, 252, 275, 486, 636
StyD4I CCNGG 2 cut(s) 16, 186
TasI AATT 9 cut(s) 10, 88, 168, 210, 394, 405, 590, 597, 607
Tru1I TTAA 3 cut(s) 317, 593, 654
Tru9I TTAA 3 cut(s) 317, 593, 654
TscAI CASTG 1 cut(s) 482
TseFI GTSAC 1 cut(s) 497
TseI GCWGC 4 cut(s) 65, 176, 580, 622
Tsp45I GTSAC 1 cut(s) 497
TspDTI ATGAA 7 cut(s) 72, 131, 339, 352, 360, 428, 479
TspRI CASTG 1 cut(s) 482
VspI ATTAAT 1 cut(s) 593
XagI CCTNNNNNAGG 1 cut(s) 21
XapI RAATTY 2 cut(s) 168, 405
XceI RCATGY 1 cut(s) 550
XspI CTAG 5 cut(s) 111, 252, 275, 486, 636
Zsp2I ATGCAT 1 cut(s) 552
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.