Rmu_co8256761.1_g000001

Potassium transporter

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co8256761.1
Physical Location & Seq
Reverse (-)
1 .. 714
714 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co8256761.1_g000001.1.cds

Sequence Viewer

Length: 244 bp
atgccgatccattccagtcagggaaaaggtagaagggagaatttgctacttgcatacaagacactgggagtagtgtttggaggacttgttacatccccactgtatgtgtacccttccatgccactcaagtctccgaccgaagatgactatttgggcatttacagcattatgttttggactcttaccctcattggggttgtcaaatatgctggcattgctctcaaagccgatgatcaaggcgaag

Protein Analysis

81

Amino Acids

8.9

Weight (kDa)

6.55

Isoelectric Point (pI)

45.57

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 40
AfaI GTAC 1 cut(s) 110
AfiI CCNNNNNNNGG 2 cut(s) 192, 193
Alw26I GTCTC 1 cut(s) 135
ApoI RAATTY 1 cut(s) 40
BclI TGATCA 1 cut(s) 232
BcoDI GTCTC 1 cut(s) 135
BmrI ACTGGG 1 cut(s) 74
BmuI ACTGGG 1 cut(s) 74
BpuEI CTTGAG 1 cut(s) 110
BsaXI ACNNNNNCTCC 2 cut(s) 72, 102
Bsc4I CCNNNNNNNGG 2 cut(s) 192, 193
Bse1I ACTGG 2 cut(s) 15, 69
Bse3DI GCAATG 1 cut(s) 213
BseGI GGATG 1 cut(s) 92
BseLI CCNNNNNNNGG 2 cut(s) 192, 193
BseMI GCAATG 1 cut(s) 213
BseNI ACTGG 2 cut(s) 15, 69
Bsh1285I CGRYCG 1 cut(s) 138
BsiEI CGRYCG 1 cut(s) 138
BslI CCNNNNNNNGG 2 cut(s) 192, 193
BsmAI GTCTC 1 cut(s) 135
Bsp143I GATC 2 cut(s) 6, 232
BsrDI GCAATG 1 cut(s) 213
BsrI ACTGG 2 cut(s) 15, 69
BssMI GATC 2 cut(s) 6, 232
Bst4CI ACNGT 1 cut(s) 102
BstC8I GCNNGC 1 cut(s) 211
BstF5I GGATG 1 cut(s) 92
BstKTI GATC 2 cut(s) 9, 235
BstMAI GTCTC 1 cut(s) 135
BstMBI GATC 2 cut(s) 6, 232
BstMCI CGRYCG 1 cut(s) 138
BstMWI GCNNNNNNNGC 3 cut(s) 162, 215, 224
BtsCI GGATG 1 cut(s) 92
BtsIMutI CAGTG 2 cut(s) 62, 98
Cac8I GCNNGC 1 cut(s) 211
Csp6I GTAC 1 cut(s) 109
CviAII CATG 1 cut(s) 118
CviJI RGCY 1 cut(s) 227
CviKI_1 RGCY 1 cut(s) 227
CviQI GTAC 1 cut(s) 109
DpnI GATC 2 cut(s) 8, 234
DpnII GATC 2 cut(s) 6, 232
FaeI CATG 1 cut(s) 121
FaiI YATR 5 cut(s) 55, 105, 119, 170, 207
FatI CATG 1 cut(s) 117
FbaI TGATCA 1 cut(s) 232
FokI GGATG 1 cut(s) 79
Hin1II CATG 1 cut(s) 121
HinfI GANTC 1 cut(s) 178
Hpy166II GTNNAC 1 cut(s) 109
Hpy188I TCNGA 1 cut(s) 135
Hpy8I GTNNAC 1 cut(s) 109
HpyAV CCTTC 2 cut(s) 27, 123
HpyCH4III ACNGT 1 cut(s) 102
HpyCH4V TGCA 1 cut(s) 53
HpyF10VI GCNNNNNNNGC 3 cut(s) 162, 215, 224
Hsp92II CATG 1 cut(s) 121
Ksp22I TGATCA 1 cut(s) 232
Kzo9I GATC 2 cut(s) 6, 232
LpnPI CCDG 4 cut(s) 5, 28, 50, 195
MaeIII GTNAC 1 cut(s) 88
MalI GATC 2 cut(s) 8, 234
MboI GATC 2 cut(s) 6, 232
MboII GAAGA 1 cut(s) 152
MluCI AATT 1 cut(s) 40
MlyI GAGTC 1 cut(s) 172
MmeI TCCRAC 1 cut(s) 158
MnlI CCTC 2 cut(s) 74, 197
MwoI GCNNNNNNNGC 3 cut(s) 162, 215, 224
NdeII GATC 2 cut(s) 6, 232
NlaIII CATG 1 cut(s) 121
PleI GAGTC 1 cut(s) 172
PpsI GAGTC 1 cut(s) 172
RsaI GTAC 1 cut(s) 110
RsaNI GTAC 1 cut(s) 109
Sau3AI GATC 2 cut(s) 6, 232
SchI GAGTC 1 cut(s) 172
SetI ASST 1 cut(s) 31
SgeI CNNG 9 cut(s) 27, 32, 62, 70, 77, 98, 130, 139, 222
SmlI CTYRAG 1 cut(s) 125
SmoI CTYRAG 1 cut(s) 125
Sse9I AATT 1 cut(s) 40
TaaI ACNGT 1 cut(s) 102
TaqII GACCGA 1 cut(s) 152
TasI AATT 1 cut(s) 40
TscAI CASTG 2 cut(s) 69, 105
TspRI CASTG 2 cut(s) 69, 105
XapI RAATTY 1 cut(s) 40
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.