Rmu_co8283127.1_g000001

Hydrolase

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co8283127.1
Physical Location & Seq
Reverse (-)
1 .. 853
853 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co8283127.1_g000001.1.cds

Sequence Viewer

Length: 201 bp
ttcttcactatcagttgacgctcaaagtttacagaaacagattgatgaactttcgagtttttcggatacacctgccccatcagtgaccagggtcttgtatactgagaaggatgtgttggcacgtagattcattaaaaacttgatgggactctctggtttgtccgttagagaggatgctgttggtaacatatttggtcgatg

Protein Analysis

66

Amino Acids

7.22

Weight (kDa)

6.07

Isoelectric Point (pI)

49.8

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AarI CACCTGC 1 cut(s) 80
Acc36I ACCTGC 1 cut(s) 80
AccI GTMKAC 1 cut(s) 99
AjnI CCWGG 1 cut(s) 87
AjuI GAANNNNNNNTTGG 2 cut(s) 99, 131
BccI CCATC 2 cut(s) 86, 137
BciT130I CCWGG 1 cut(s) 89
BciVI GTATCC 1 cut(s) 59
BfuAI ACCTGC 1 cut(s) 80
BfuI GTATCC 1 cut(s) 59
Bme1390I CCNGG 1 cut(s) 89
BmrFI CCNGG 1 cut(s) 89
BmsI GCATC 1 cut(s) 164
BoxI GACNNNNGTC 1 cut(s) 90
BsaAI YACGTR 1 cut(s) 123
BsaJI CCNNGG 1 cut(s) 88
BseBI CCWGG 1 cut(s) 89
BseDI CCNNGG 1 cut(s) 88
BseGI GGATG 2 cut(s) 116, 179
BseMII CTCAG 1 cut(s) 94
BslFI GGGAC 1 cut(s) 160
BsmFI GGGAC 1 cut(s) 160
BspCNI CTCAG 1 cut(s) 95
BspMI ACCTGC 1 cut(s) 80
BssECI CCNNGG 1 cut(s) 88
BssNAI GTATAC 1 cut(s) 100
Bst1107I GTATAC 1 cut(s) 100
Bst2UI CCWGG 1 cut(s) 89
BstBAI YACGTR 1 cut(s) 123
BstDEI CTNAG 1 cut(s) 103
BstF5I GGATG 2 cut(s) 116, 179
BstNI CCWGG 1 cut(s) 89
BstPAI GACNNNNGTC 1 cut(s) 90
BstSCI CCNGG 1 cut(s) 87
BstZ17I GTATAC 1 cut(s) 100
BsuI GTATCC 1 cut(s) 59
BtsCI GGATG 2 cut(s) 116, 179
BtsIMutI CAGTG 1 cut(s) 88
BveI ACCTGC 1 cut(s) 80
CseI GACGC 1 cut(s) 27
DdeI CTNAG 1 cut(s) 103
EcoRII CCWGG 1 cut(s) 87
FaiI YATR 2 cut(s) 100, 189
FaqI GGGAC 1 cut(s) 160
FblI GTMKAC 1 cut(s) 99
FokI GGATG 2 cut(s) 123, 186
HgaI GACGC 1 cut(s) 27
HincII GTYRAC 1 cut(s) 17
HindII GTYRAC 1 cut(s) 17
HinfI GANTC 2 cut(s) 127, 148
Hpy166II GTNNAC 3 cut(s) 17, 30, 100
Hpy188I TCNGA 1 cut(s) 65
Hpy8I GTNNAC 3 cut(s) 17, 30, 100
HpyAV CCTTC 1 cut(s) 101
HpyCH4IV ACGT 1 cut(s) 122
HpyF3I CTNAG 1 cut(s) 103
HpySE526I ACGT 1 cut(s) 122
LpnPI CCDG 4 cut(s) 74, 85, 101, 139
LweI GCATC 1 cut(s) 164
MaeII ACGT 1 cut(s) 122
MaeIII GTNAC 2 cut(s) 83, 183
MlyI GAGTC 1 cut(s) 142
MnlI CCTC 1 cut(s) 164
MseI TTAA 1 cut(s) 133
MspR9I CCNGG 1 cut(s) 89
MvaI CCWGG 1 cut(s) 89
NmuCI GTSAC 1 cut(s) 83
PaqCI CACCTGC 1 cut(s) 80
PfeI GAWTC 1 cut(s) 127
PleI GAGTC 1 cut(s) 142
PpsI GAGTC 1 cut(s) 142
Ppu21I YACGTR 1 cut(s) 123
PshAI GACNNNNGTC 1 cut(s) 90
Psp6I CCWGG 1 cut(s) 87
PspGI CCWGG 1 cut(s) 87
SaqAI TTAA 1 cut(s) 133
SchI GAGTC 1 cut(s) 142
ScrFI CCNGG 1 cut(s) 89
SetI ASST 2 cut(s) 74, 125
SfaNI GCATC 1 cut(s) 164
SgeI CNNG 8 cut(s) 67, 84, 100, 101, 107, 133, 152, 166
StyD4I CCNGG 1 cut(s) 87
TaiI ACGT 1 cut(s) 125
TaqI TCGA 2 cut(s) 54, 197
TfiI GAWTC 1 cut(s) 127
Tru1I TTAA 1 cut(s) 133
Tru9I TTAA 1 cut(s) 133
TscAI CASTG 1 cut(s) 88
TseFI GTSAC 1 cut(s) 83
Tsp45I GTSAC 1 cut(s) 83
TspDTI ATGAA 2 cut(s) 61, 119
TspGWI ACGGA 1 cut(s) 152
TspRI CASTG 1 cut(s) 88
XmiI GTMKAC 1 cut(s) 99
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.