Rmu_co8295257.1_g000001

No description available

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co8295257.1
Physical Location & Seq
Reverse (-)
1 .. 847
847 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co8295257.1_g000001.1.cds

Sequence Viewer

Length: 628 bp
atggaggtggtggaagattgtggggctagtgaggtagaaaataggaggaggagagttgaagagaggtgtgaggagttagagttggagattgtgaagagaaagagtgagtatgaagatcttgagattaagtttcgggctttggaaggcgaaaagcttgcgatggaagaagagattagggcattgaagagaggaagtgatgaaattaggaagcaagctaatgggggtggagatgggacggagataatagttgattttaatgaggatagcttggagggagatggggtctttcagcttatgcttgagaacaaggtgttggagtgtgagaagaagactgctgaaagtgaggttgaggcttggaagcagaagttcaaagaattgaagacgtgggtcttgaagttggacaaggatttagtcttgaaaggtggggagtttccgtggaacttaactggggattccgttgaagcaagcaggagaacacaaccgaatgaaaggattgaacttgaggatgggttgaatgttggagttggcatggaaagttcaaggagcaaagatatagctgtgaatgttattgatcttagctctacatatcactcccctggtaaagagatctgccatctgcaagaagcag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

209

Amino Acids

23.81

Weight (kDa)

4.69

Isoelectric Point (pI)

58.11

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AjiI CACGTC 1 cut(s) 384
AjnI CCWGG 1 cut(s) 595
AjuI GAANNNNNNNTTGG 2 cut(s) 296, 328
AluBI AGCT 6 cut(s) 154, 215, 267, 292, 557, 579
AluI AGCT 6 cut(s) 154, 215, 267, 292, 557, 579
BbsI GAAGAC 2 cut(s) 335, 386
BccI CCATC 5 cut(s) 154, 224, 272, 500, 621
BcgI CGANNNNNNTGC 2 cut(s) 137, 171
BciT130I CCWGG 1 cut(s) 597
BfaI CTAG 1 cut(s) 27
BglII AGATCT 2 cut(s) 115, 606
Bme1390I CCNGG 1 cut(s) 597
BmgBI CACGTC 1 cut(s) 384
BmrFI CCNGG 1 cut(s) 597
BmrI ACTGGG 1 cut(s) 456
BmuI ACTGGG 1 cut(s) 456
BoxI GACNNNNGTC 1 cut(s) 386
BpiI GAAGAC 2 cut(s) 335, 386
BpuEI CTTGAG 3 cut(s) 140, 320, 521
BsaJI CCNNGG 2 cut(s) 434, 595
BsaXI ACNNNNNCTCC 6 cut(s) 65, 95, 267, 297, 419, 449
Bse1I ACTGG 1 cut(s) 451
BseBI CCWGG 1 cut(s) 597
BseDI CCNNGG 2 cut(s) 434, 595
BseGI GGATG 1 cut(s) 511
BseNI ACTGG 1 cut(s) 451
BseRI GAGGAG 3 cut(s) 61, 64, 86
BslFI GGGAC 1 cut(s) 247
BsmFI GGGAC 1 cut(s) 247
Bsp143I GATC 3 cut(s) 115, 571, 606
BsrI ACTGG 1 cut(s) 451
BssECI CCNNGG 2 cut(s) 434, 595
BssMI GATC 3 cut(s) 115, 571, 606
Bst2UI CCWGG 1 cut(s) 597
Bst6I CTCTTC 4 cut(s) 54, 89, 162, 179
BstC8I GCNNGC 3 cut(s) 156, 213, 466
BstDEI CTNAG 1 cut(s) 575
BstDSI CCRYGG 1 cut(s) 434
BstF5I GGATG 1 cut(s) 511
BstKTI GATC 3 cut(s) 118, 574, 609
BstMBI GATC 3 cut(s) 115, 571, 606
BstNI CCWGG 1 cut(s) 597
BstPAI GACNNNNGTC 1 cut(s) 386
BstSCI CCNGG 1 cut(s) 595
BstV2I GAAGAC 2 cut(s) 335, 386
BstX2I RGATCY 2 cut(s) 115, 606
BstYI RGATCY 2 cut(s) 115, 606
BtgI CCRYGG 1 cut(s) 434
BtgZI GCGATG 1 cut(s) 173
BtrI CACGTC 1 cut(s) 384
BtsCI GGATG 1 cut(s) 511
Cac8I GCNNGC 3 cut(s) 156, 213, 466
CviAII CATG 1 cut(s) 529
CviJI RGCY 9 cut(s) 26, 137, 154, 215, 267, 292, 353, 557, 579
CviKI_1 RGCY 9 cut(s) 26, 137, 154, 215, 267, 292, 353, 557, 579
DdeI CTNAG 1 cut(s) 575
DpnI GATC 3 cut(s) 117, 573, 608
DpnII GATC 3 cut(s) 115, 571, 606
Eam1104I CTCTTC 4 cut(s) 54, 89, 162, 179
EarI CTCTTC 4 cut(s) 54, 89, 162, 179
EcoRII CCWGG 1 cut(s) 595
FaeI CATG 1 cut(s) 532
FaiI YATR 5 cut(s) 111, 296, 530, 554, 586
FaqI GGGAC 1 cut(s) 247
FatI CATG 1 cut(s) 528
FokI GGATG 1 cut(s) 518
FspBI CTAG 1 cut(s) 27
Hin1II CATG 1 cut(s) 532
HindIII AAGCTT 1 cut(s) 152
HinfI GANTC 1 cut(s) 452
Hpy188III TCNNGA 3 cut(s) 119, 391, 415
HpyAV CCTTC 1 cut(s) 137
HpyCH4IV ACGT 1 cut(s) 383
HpyCH4V TGCA 1 cut(s) 619
HpyF3I CTNAG 1 cut(s) 575
HpySE526I ACGT 1 cut(s) 383
Hsp92II CATG 1 cut(s) 532
Kzo9I GATC 3 cut(s) 115, 571, 606
LmnI GCTCC 1 cut(s) 543
LpnPI CCDG 4 cut(s) 432, 454, 582, 609
MaeI CTAG 1 cut(s) 27
MaeII ACGT 1 cut(s) 383
MalI GATC 3 cut(s) 117, 573, 608
MboI GATC 3 cut(s) 115, 571, 606
MflI RGATCY 2 cut(s) 115, 606
MluCI AATT 2 cut(s) 201, 374
MmeI TCCRAC 4 cut(s) 63, 294, 378, 499
MseI TTAA 3 cut(s) 126, 255, 443
MspR9I CCNGG 1 cut(s) 597
MvaI CCWGG 1 cut(s) 597
NdeII GATC 3 cut(s) 115, 571, 606
NlaIII CATG 1 cut(s) 532
PfeI GAWTC 1 cut(s) 452
PshAI GACNNNNGTC 1 cut(s) 386
Psp6I CCWGG 1 cut(s) 595
PspGI CCWGG 1 cut(s) 595
PsuI RGATCY 2 cut(s) 115, 606
SaqAI TTAA 3 cut(s) 126, 255, 443
Sau3AI GATC 3 cut(s) 115, 571, 606
ScrFI CCNGG 1 cut(s) 597
SmlI CTYRAG 3 cut(s) 119, 299, 500
SmoI CTYRAG 3 cut(s) 119, 299, 500
Sse9I AATT 2 cut(s) 201, 374
SspMI CTAG 1 cut(s) 27
StyD4I CCNGG 1 cut(s) 595
TaiI ACGT 1 cut(s) 386
TasI AATT 2 cut(s) 201, 374
TfiI GAWTC 1 cut(s) 452
Tru1I TTAA 3 cut(s) 126, 255, 443
Tru9I TTAA 3 cut(s) 126, 255, 443
TspDTI ATGAA 3 cut(s) 126, 213, 501
TspGWI ACGGA 3 cut(s) 251, 423, 445
XspI CTAG 1 cut(s) 27
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.