Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_co8333427.1

Orthogroup ID

OG0005349

Physical Location & Seq

Genomic Coordinates Reverse (-)

1 .. 918

Gene Structure 918 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_co8333427.1_g000001.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 237 bp

atgggcggatcatatgatcctgatacattggaagcgttaaacggagagttggccatccccttggccaatggtgatcagttgaagcttcatatgtccaaggaagcagacaggaaattcattactagccttttggcgctcatccgcaattttagaagggcaatggagttgcatgaagatttgttgcatagtatccacagtccggctgagctattaacaggcagttttgatggcatcaag

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

ko04614 map04614

Pfam Domains

Protein Families

No domains found.

Protein Analysis

79

Amino Acids

8.74

Weight (kDa)

5.41

Isoelectric Point (pI)

25.08

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0005349)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT3G24160
fragaria_vesca	FvH4_4g00480 FvH4_4g00480 FvH4_4g00480 FvH4_4g00480
malus_domestica	MD04G1005200.v1.1 MD04G1005300.v1.1 MD07G1287300.v1.1
prunus_persica	Prupe.1G005000_v2.0.a1 Prupe.1G005000_v2.0.a1 Prupe.1G005000_v2.0.a1 Prupe.1G005000_v2.0.a1 Prupe.1G005000_v2.0.a1
pyrus_communis	pycom04g00500
rosa_chinensis	RchiOBHm_Chr4g0385791 RchiOBHm_Chr4g0385911
rosa_laevigata	RLG00000010202
rosa_multiflora	Rmu_co8333427.1_g000001 Rmu_sc0007400.1_g000009 Rmu_sc0008728.1_g000001 Rmu_sc0024454.1_g000002
rosa_roxburghii	Rroxscaffold_5G00333510
rosa_rugosa	Rorug03G0302700 Rorug03G0302800
rosa_samantha	Rh4AG007400 Rh4BG005200 Rh4CG008000 Rh4DG006900
rosa_wichuraiana	Rw4G000330

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AciI	CCGC	2 cut(s)	6, 142
AclWI	GGATC	2 cut(s)	11, 16
AcoI	YGGCCR	2 cut(s)	51, 63
AcsI	RAATTY	1 cut(s)	113
AfiI	CCNNNNNNNGG	1 cut(s)	199
AgsI	TTSAA	1 cut(s)	82
AluBI	AGCT	2 cut(s)	85, 208
AluI	AGCT	2 cut(s)	85, 208
AlwI	GGATC	2 cut(s)	11, 16
AoxI	GGCC	2 cut(s)	51, 63
ApoI	RAATTY	1 cut(s)	113
AspLEI	GCGC	1 cut(s)	136
AsuHPI	GGTGA	1 cut(s)	83
BalI	TGGCCA	2 cut(s)	53, 65
BccI	CCATC	2 cut(s)	62, 221
BciVI	GTATCC	1 cut(s)	200
BclI	TGATCA	1 cut(s)	73
BfaI	CTAG	1 cut(s)	123
BfoI	RGCGCY	1 cut(s)	137
BfuI	GTATCC	1 cut(s)	200
BlpI	GCTNAGC	1 cut(s)	204
Bpu1102I	GCTNAGC	1 cut(s)	204
BsaJI	CCNNGG	2 cut(s)	60, 96
Bsc4I	CCNNNNNNNGG	1 cut(s)	199
Bse3DI	GCAATG	1 cut(s)	165
BseDI	CCNNGG	2 cut(s)	60, 96
BseGI	GGATG	2 cut(s)	54, 138
BseLI	CCNNNNNNNGG	1 cut(s)	199
BseMI	GCAATG	1 cut(s)	165
BseMII	CTCAG	1 cut(s)	195
BshFI	GGCC	2 cut(s)	53, 65
BsiSI	CCGG	1 cut(s)	200
BslI	CCNNNNNNNGG	1 cut(s)	199
BsnI	GGCC	2 cut(s)	53, 65
Bsp143I	GATC	3 cut(s)	8, 16, 73
Bsp1720I	GCTNAGC	1 cut(s)	204
BspACI	CCGC	2 cut(s)	6, 142
BspANI	GGCC	2 cut(s)	53, 65
BspCNI	CTCAG	1 cut(s)	196
BspPI	GGATC	2 cut(s)	11, 16
BsrDI	GCAATG	1 cut(s)	165
BssECI	CCNNGG	2 cut(s)	60, 96
BssMI	GATC	3 cut(s)	8, 16, 73
BssT1I	CCWWGG	2 cut(s)	60, 96
Bst4CI	ACNGT	1 cut(s)	197
BstDEI	CTNAG	1 cut(s)	204
BstF5I	GGATG	2 cut(s)	54, 138
BstH2I	RGCGCY	1 cut(s)	137
BstHHI	GCGC	1 cut(s)	136
BstKTI	GATC	3 cut(s)	11, 19, 76
BstMBI	GATC	3 cut(s)	8, 16, 73
BstXI	CCANNNNNNTGG	1 cut(s)	61
BsuI	GTATCC	1 cut(s)	200
BsuRI	GGCC	2 cut(s)	53, 65
BtsCI	GGATG	2 cut(s)	54, 138
CfoI	GCGC	1 cut(s)	136
CviAII	CATG	1 cut(s)	170
CviJI	RGCY	6 cut(s)	53, 65, 85, 126, 203, 208
CviKI_1	RGCY	6 cut(s)	53, 65, 85, 126, 203, 208
DdeI	CTNAG	1 cut(s)	204
DpnI	GATC	3 cut(s)	10, 18, 75
DpnII	GATC	3 cut(s)	8, 16, 73
EaeI	YGGCCR	2 cut(s)	51, 63
EciI	GGCGGA	1 cut(s)	21
Eco130I	CCWWGG	2 cut(s)	60, 96
EcoT14I	CCWWGG	2 cut(s)	60, 96
ErhI	CCWWGG	2 cut(s)	60, 96
FaeI	CATG	1 cut(s)	173
FaiI	YATR	6 cut(s)	13, 15, 90, 92, 171, 186
FatI	CATG	1 cut(s)	169
FauNDI	CATATG	2 cut(s)	13, 90
FbaI	TGATCA	1 cut(s)	73
FokI	GGATG	2 cut(s)	41, 125
FspBI	CTAG	1 cut(s)	123
GlaI	GCGC	1 cut(s)	135
HaeII	RGCGCY	1 cut(s)	137
HaeIII	GGCC	2 cut(s)	53, 65
HapII	CCGG	1 cut(s)	200
HhaI	GCGC	1 cut(s)	136
Hin1II	CATG	1 cut(s)	173
Hin6I	GCGC	1 cut(s)	134
HinP1I	GCGC	1 cut(s)	134
HindIII	AAGCTT	1 cut(s)	83
HpaII	CCGG	1 cut(s)	200
HphI	GGTGA	1 cut(s)	83
Hpy188III	TCNNGA	1 cut(s)	20
HpyAV	CCTTC	1 cut(s)	147
HpyCH4III	ACNGT	1 cut(s)	197
HpyCH4V	TGCA	2 cut(s)	169, 184
HpyF3I	CTNAG	1 cut(s)	204
Hsp92II	CATG	1 cut(s)	173
HspAI	GCGC	1 cut(s)	134
Ksp22I	TGATCA	1 cut(s)	73
Kzo9I	GATC	3 cut(s)	8, 16, 73
LpnPI	CCDG	4 cut(s)	33, 94, 201, 213
MaeI	CTAG	1 cut(s)	123
MalI	GATC	3 cut(s)	10, 18, 75
MboI	GATC	3 cut(s)	8, 16, 73
MboII	GAAGA	1 cut(s)	185
MlsI	TGGCCA	2 cut(s)	53, 65
MluCI	AATT	2 cut(s)	113, 145
MluNI	TGGCCA	2 cut(s)	53, 65
Mox20I	TGGCCA	2 cut(s)	53, 65
MscI	TGGCCA	2 cut(s)	53, 65
MseI	TTAA	2 cut(s)	38, 212
Msp20I	TGGCCA	2 cut(s)	53, 65
MspI	CCGG	1 cut(s)	200
NdeI	CATATG	2 cut(s)	13, 90
NdeII	GATC	3 cut(s)	8, 16, 73
NlaIII	CATG	1 cut(s)	173
SaqAI	TTAA	2 cut(s)	38, 212
Sau3AI	GATC	3 cut(s)	8, 16, 73
SetI	ASST	2 cut(s)	87, 210
SgeI	CNNG	8 cut(s)	32, 73, 109, 121, 135, 182, 212, 228
Sse9I	AATT	2 cut(s)	113, 145
SsiI	CCGC	2 cut(s)	6, 142
SspMI	CTAG	1 cut(s)	123
StyI	CCWWGG	2 cut(s)	60, 96
TaaI	ACNGT	1 cut(s)	197
TasI	AATT	2 cut(s)	113, 145
Tru1I	TTAA	2 cut(s)	38, 212
Tru9I	TTAA	2 cut(s)	38, 212
TspDTI	ATGAA	3 cut(s)	77, 106, 186
TspGWI	ACGGA	1 cut(s)	57
XapI	RAATTY	1 cut(s)	113
XspI	CTAG	1 cut(s)	123

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.