Rmu_sc0008728.1_g000001

Type 1 membrane protein

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0008728.1
Physical Location & Seq
Forward (+)
12568 .. 13570
1003 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0008728.1_g000001.1.cds

Sequence Viewer

Length: 339 bp
atggaagtgctagttgctgtaatgactaagatatttgattttctcgaacattcatacaaaggtcaaattgttggagctatcctctttgatggagtagcacctgttgaatcagggaatatgttgaatgtggtgtttaccagtcgaccatctgctcgttggctggcagaaacaaagaccccaacaaatacaactgttgtggaagtgctattggttagaaaaacaattgcttggatcacaggaattatccttctcattgcaactctcttgggggtatacttccttctgaatatgccaatcaccagggatacgttactgtactctaatgtcaagctggactag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
Pfam Domains
Protein Families
No domains found.

Protein Analysis

112

Amino Acids

12.44

Weight (kDa)

6.56

Isoelectric Point (pI)

23.21

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 2 cut(s) 142, 273
AclWI GGATC 1 cut(s) 239
AfaI GTAC 1 cut(s) 317
AgsI TTSAA 2 cut(s) 107, 124
AjnI CCWGG 1 cut(s) 299
AluBI AGCT 2 cut(s) 77, 331
AluI AGCT 2 cut(s) 77, 331
AlwI GGATC 1 cut(s) 239
AsuHPI GGTGA 1 cut(s) 289
BarI GAAGNNNNNNTAC 2 cut(s) 264, 296
BccI CCATC 2 cut(s) 83, 154
BciT130I CCWGG 1 cut(s) 301
BciVI GTATCC 1 cut(s) 298
BfaI CTAG 2 cut(s) 11, 337
BfuI GTATCC 1 cut(s) 298
Bme1390I CCNGG 1 cut(s) 301
BmrFI CCNGG 1 cut(s) 301
BplI GAGNNNNNCTC 2 cut(s) 66, 98
BsaJI CCNNGG 1 cut(s) 300
Bse1I ACTGG 1 cut(s) 138
Bse3DI GCAATG 1 cut(s) 252
BseBI CCWGG 1 cut(s) 301
BseDI CCNNGG 1 cut(s) 300
BseMI GCAATG 1 cut(s) 252
BseNI ACTGG 1 cut(s) 138
Bsp143I GATC 1 cut(s) 231
BspPI GGATC 1 cut(s) 239
BsrDI GCAATG 1 cut(s) 252
BsrI ACTGG 1 cut(s) 138
BssECI CCNNGG 1 cut(s) 300
BssMI GATC 1 cut(s) 231
BssNAI GTATAC 1 cut(s) 274
Bst1107I GTATAC 1 cut(s) 274
Bst2UI CCWGG 1 cut(s) 301
Bst4CI ACNGT 2 cut(s) 193, 315
BstC8I GCNNGC 1 cut(s) 162
BstDEI CTNAG 1 cut(s) 27
BstKTI GATC 1 cut(s) 234
BstMBI GATC 1 cut(s) 231
BstNI CCWGG 1 cut(s) 301
BstSCI CCNGG 1 cut(s) 299
BstZ17I GTATAC 1 cut(s) 274
BsuI GTATCC 1 cut(s) 298
Cac8I GCNNGC 1 cut(s) 162
Csp6I GTAC 1 cut(s) 316
CspCI CAANNNNNGTGG 2 cut(s) 177, 212
CviJI RGCY 3 cut(s) 77, 160, 331
CviKI_1 RGCY 3 cut(s) 77, 160, 331
CviQI GTAC 1 cut(s) 316
DdeI CTNAG 1 cut(s) 27
DpnI GATC 1 cut(s) 233
DpnII GATC 1 cut(s) 231
EcoRII CCWGG 1 cut(s) 299
FaiI YATR 4 cut(s) 55, 119, 274, 290
FblI GTMKAC 2 cut(s) 142, 273
FspBI CTAG 2 cut(s) 11, 337
HincII GTYRAC 1 cut(s) 143
HindII GTYRAC 1 cut(s) 143
HinfI GANTC 1 cut(s) 107
HphI GGTGA 1 cut(s) 289
Hpy166II GTNNAC 3 cut(s) 135, 143, 274
Hpy188I TCNGA 1 cut(s) 285
Hpy188III TCNNGA 1 cut(s) 44
Hpy8I GTNNAC 3 cut(s) 135, 143, 274
HpyAV CCTTC 2 cut(s) 257, 290
HpyCH4III ACNGT 2 cut(s) 193, 315
HpyCH4IV ACGT 1 cut(s) 308
HpyCH4V TGCA 1 cut(s) 257
HpyF3I CTNAG 1 cut(s) 27
HpySE526I ACGT 1 cut(s) 308
Kzo9I GATC 1 cut(s) 231
LmnI GCTCC 1 cut(s) 74
LpnPI CCDG 8 cut(s) 96, 114, 146, 151, 222, 286, 313, 317
MaeI CTAG 2 cut(s) 11, 337
MaeII ACGT 1 cut(s) 308
MaeIII GTNAC 1 cut(s) 309
MalI GATC 1 cut(s) 233
MboI GATC 1 cut(s) 231
MfeI CAATTG 1 cut(s) 222
MluCI AATT 3 cut(s) 66, 222, 240
MmeI TCCRAC 1 cut(s) 52
MnlI CCTC 1 cut(s) 92
MspR9I CCNGG 1 cut(s) 301
MunI CAATTG 1 cut(s) 222
MvaI CCWGG 1 cut(s) 301
NdeII GATC 1 cut(s) 231
PfeI GAWTC 1 cut(s) 107
Psp6I CCWGG 1 cut(s) 299
PspGI CCWGG 1 cut(s) 299
RsaI GTAC 1 cut(s) 317
RsaNI GTAC 1 cut(s) 316
SalI GTCGAC 1 cut(s) 141
Sau3AI GATC 1 cut(s) 231
ScrFI CCNGG 1 cut(s) 301
SetI ASST 5 cut(s) 64, 79, 103, 311, 333
Sse9I AATT 3 cut(s) 66, 222, 240
SspMI CTAG 2 cut(s) 11, 337
StyD4I CCNGG 1 cut(s) 299
TaaI ACNGT 2 cut(s) 193, 315
TaiI ACGT 1 cut(s) 311
TaqI TCGA 2 cut(s) 45, 142
TasI AATT 3 cut(s) 66, 222, 240
TatI WGTACW 1 cut(s) 315
TfiI GAWTC 1 cut(s) 107
TspDTI ATGAA 1 cut(s) 42
XcmI CCANNNNNNNNNTGG 1 cut(s) 153
XmiI GTMKAC 2 cut(s) 142, 273
XspI CTAG 2 cut(s) 11, 337
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.