Rmu_co8368331.1_g000001

Vacuolar protein sorting-associated protein VTA1 homolog

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co8368331.1
Physical Location & Seq
Forward (+)
1 .. 900
900 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co8368331.1_g000001.1.cds

Sequence Viewer

Length: 339 bp
gataaaaagtcactgcagttggggcctgaagacaatctgtatcttgagggatttgctttaaatgtttttgggaaggcagacaagcaagatcgtgctggtcgagcagatttgaatactgctaaaaccttctatgctgcaagcattttctttgagattattaaccagtttggtgtgcttcaacctgatcttgagcagaaacagaagtatgcggcttggaaagcagcagatataaggaaagctgtcaaggaaggaaggaaacctcaggctggcccccctgctggtgatgatgatctttcagttccctcgagtacaactagtggttcatatgtatggttctaa

Protein Analysis

112

Amino Acids

12.33

Weight (kDa)

6.46

Isoelectric Point (pI)

39.73

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 209
AcuI CTGAAG 1 cut(s) 48
AfaI GTAC 1 cut(s) 310
AfiI CCNNNNNNNGG 2 cut(s) 266, 278
AgsI TTSAA 2 cut(s) 112, 179
AhlI ACTAGT 1 cut(s) 314
AluBI AGCT 1 cut(s) 239
AluI AGCT 1 cut(s) 239
Ama87I CYCGRG 1 cut(s) 304
AoxI GGCC 2 cut(s) 23, 268
ApeKI GCWGC 2 cut(s) 134, 221
AspS9I GGNCC 2 cut(s) 23, 269
AsuHPI GGTGA 1 cut(s) 293
AvaI CYCGRG 1 cut(s) 304
AxyI CCTNAGG 1 cut(s) 261
BbsI GAAGAC 1 cut(s) 36
BbvI GCAGC 2 cut(s) 121, 233
BcuI ACTAGT 1 cut(s) 314
BfaI CTAG 1 cut(s) 315
BfmI CTRYAG 1 cut(s) 14
BisI GCNGC 3 cut(s) 135, 210, 222
BlsI GCNGC 3 cut(s) 136, 211, 223
BmeT110I CYCGRG 1 cut(s) 304
BmgT120I GGNCC 2 cut(s) 23, 269
BmiI GGNNCC 2 cut(s) 24, 271
BpiI GAAGAC 1 cut(s) 36
BpuEI CTTGAG 2 cut(s) 65, 209
BsaBI GATNNNNATC 1 cut(s) 288
Bsc4I CCNNNNNNNGG 2 cut(s) 266, 278
Bse1I ACTGG 1 cut(s) 163
Bse21I CCTNAGG 1 cut(s) 261
Bse8I GATNNNNATC 1 cut(s) 288
BseJI GATNNNNATC 1 cut(s) 288
BseLI CCNNNNNNNGG 2 cut(s) 266, 278
BseMII CTCAG 1 cut(s) 275
BseNI ACTGG 1 cut(s) 163
BseXI GCAGC 2 cut(s) 121, 233
BshFI GGCC 2 cut(s) 25, 270
BsiHKCI CYCGRG 1 cut(s) 304
BslI CCNNNNNNNGG 2 cut(s) 266, 278
BsnI GGCC 2 cut(s) 25, 270
BsoBI CYCGRG 1 cut(s) 304
Bsp143I GATC 3 cut(s) 88, 184, 289
BspACI CCGC 1 cut(s) 209
BspANI GGCC 2 cut(s) 25, 270
BspCNI CTCAG 1 cut(s) 274
BspLI GGNNCC 2 cut(s) 24, 271
BspMAI CTGCAG 1 cut(s) 18
BsrI ACTGG 1 cut(s) 163
BssMI GATC 3 cut(s) 88, 184, 289
BstC8I GCNNGC 2 cut(s) 139, 268
BstDEI CTNAG 1 cut(s) 261
BstKTI GATC 3 cut(s) 91, 187, 292
BstMBI GATC 3 cut(s) 88, 184, 289
BstMWI GCNNNNNNNGC 3 cut(s) 22, 101, 218
BstSFI CTRYAG 1 cut(s) 14
BstV1I GCAGC 2 cut(s) 121, 233
BstV2I GAAGAC 1 cut(s) 36
Bsu36I CCTNAGG 1 cut(s) 261
BsuRI GGCC 2 cut(s) 25, 270
BtsI GCAGTG 1 cut(s) 11
BtsIMutI CAGTG 1 cut(s) 11
Cac8I GCNNGC 2 cut(s) 139, 268
Cfr13I GGNCC 2 cut(s) 23, 269
Csp6I GTAC 1 cut(s) 309
CviJI RGCY 5 cut(s) 25, 212, 239, 266, 270
CviKI_1 RGCY 5 cut(s) 25, 212, 239, 266, 270
CviQI GTAC 1 cut(s) 309
DdeI CTNAG 1 cut(s) 261
DpnI GATC 3 cut(s) 90, 186, 291
DpnII GATC 3 cut(s) 88, 184, 289
DraI TTTAAA 1 cut(s) 60
Eco57I CTGAAG 1 cut(s) 48
Eco81I CCTNAGG 1 cut(s) 261
Eco88I CYCGRG 1 cut(s) 304
EcoO109I RGGNCCY 1 cut(s) 23
FaiI YATR 6 cut(s) 132, 207, 230, 325, 327, 331
FauNDI CATATG 1 cut(s) 325
Fnu4HI GCNGC 3 cut(s) 135, 210, 222
Fsp4HI GCNGC 3 cut(s) 135, 210, 222
FspBI CTAG 1 cut(s) 315
GluI GCNGC 3 cut(s) 135, 210, 222
HaeIII GGCC 2 cut(s) 25, 270
HphI GGTGA 1 cut(s) 293
Hpy188III TCNNGA 2 cut(s) 44, 188
HpyAV CCTTC 4 cut(s) 67, 136, 242, 246
HpyCH4V TGCA 2 cut(s) 16, 137
HpyF10VI GCNNNNNNNGC 3 cut(s) 22, 101, 218
HpyF3I CTNAG 1 cut(s) 261
Kzo9I GATC 3 cut(s) 88, 184, 289
LpnPI CCDG 8 cut(s) 39, 81, 176, 195, 248, 252, 264, 288
Lsp1109I GCAGC 2 cut(s) 121, 233
MaeI CTAG 1 cut(s) 315
MaeIII GTNAC 1 cut(s) 9
MalI GATC 3 cut(s) 90, 186, 291
MboI GATC 3 cut(s) 88, 184, 289
MboII GAAGA 1 cut(s) 41
MnlI CCTC 3 cut(s) 40, 270, 313
MseI TTAA 2 cut(s) 59, 159
MslI CAYNNNNRTG 1 cut(s) 328
MwoI GCNNNNNNNGC 3 cut(s) 22, 101, 218
NdeI CATATG 1 cut(s) 325
NdeII GATC 3 cut(s) 88, 184, 289
NlaIV GGNNCC 2 cut(s) 24, 271
NmuCI GTSAC 1 cut(s) 9
PaeR7I CTCGAG 1 cut(s) 304
PcsI WCGNNNNNNNCGW 1 cut(s) 97
PkrI GCNGC 3 cut(s) 136, 211, 223
PspN4I GGNNCC 2 cut(s) 24, 271
PspPI GGNCC 2 cut(s) 23, 269
PspXI VCTCGAGB 1 cut(s) 304
PstI CTGCAG 1 cut(s) 18
RsaI GTAC 1 cut(s) 310
RsaNI GTAC 1 cut(s) 309
RseI CAYNNNNRTG 1 cut(s) 328
SaqAI TTAA 2 cut(s) 59, 159
SatI GCNGC 3 cut(s) 135, 210, 222
Sau3AI GATC 3 cut(s) 88, 184, 289
Sau96I GGNCC 2 cut(s) 23, 269
SetI ASST 4 cut(s) 128, 184, 241, 262
SfcI CTRYAG 1 cut(s) 14
Sfr274I CTCGAG 1 cut(s) 304
SlaI CTCGAG 1 cut(s) 304
SmiMI CAYNNNNRTG 1 cut(s) 328
SmlI CTYRAG 3 cut(s) 44, 188, 304
SmoI CTYRAG 3 cut(s) 44, 188, 304
SpeI ACTAGT 1 cut(s) 314
SsiI CCGC 1 cut(s) 209
SspMI CTAG 1 cut(s) 315
TaqI TCGA 2 cut(s) 100, 305
TatI WGTACW 1 cut(s) 308
TauI GCSGC 1 cut(s) 212
Tru1I TTAA 2 cut(s) 59, 159
Tru9I TTAA 2 cut(s) 59, 159
TscAI CASTG 1 cut(s) 18
TseFI GTSAC 1 cut(s) 9
TseI GCWGC 2 cut(s) 134, 221
Tsp45I GTSAC 1 cut(s) 9
TspDTI ATGAA 1 cut(s) 312
TspRI CASTG 1 cut(s) 18
XhoI CTCGAG 1 cut(s) 304
XspI CTAG 1 cut(s) 315
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.