Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_co8374983.1

Orthogroup ID

OG0006872

Physical Location & Seq

Genomic Coordinates Forward (+)

200 .. 721

Gene Structure 522 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_co8374983.1_g000001.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 522 bp

atgttgccgtctttctttaatgggaagtctgatgctcgaactcccgatacatacctggagatacgcaattgtattatgaaaaaattccatgcaaatccgggaacattggttgaactgaaggatatgttggagcttgaagtgggagacttcgattcaagacaagaattaatggaatttttggaccactggggtttgataaatttccaccctttcccaccaacaggttctactgttgcaaatgtcaacagtgatgaggtgacagaaagggattctttggtagataagttgtatcactttgaagcactagaatcacgatcatcagtggttcctaagactaacttatttactccaactgtgccatctggtctgttcccagagtctacatttgctgacgaattggtgaggcctgaggggccagctgttgagtaccattgcaactcttgttcagctgattgctcacgcaaacgctaccattgccagaagcaggtcggttctatcatacaattcctgatttttcattga

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

ko04714 ko05225 map04714 map05225

Pfam Domains

Protein Families

Myb_DNA-binding SWIRM SWIRM-assoc_1 ZZ

Protein Analysis

173

Amino Acids

19.66

Weight (kDa)

5.18

Isoelectric Point (pI)

35.29

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0006872)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT4G34430 AT4G34430 AT4G34430 AT4G34430
fragaria_vesca	FvH4_2g08620 FvH4_2g08620
malus_domestica	MD05G1067900.v1.1 MD10G1077800.v1.1
prunus_persica	Prupe.8G098500_v2.0.a1
pyrus_communis	pycom05g05880 pycom10g06070
rosa_chinensis	RchiOBHm_Chr6g0263951
rosa_laevigata	RLG00000014300
rosa_multiflora	Rmu_co8374983.1_g000001 Rmu_sc0002112.1_g000023 Rmu_sc0034069.1_g000004
rosa_roxburghii	Rroxscaffold_176G00431340 Rroxscaffold_7G00203710
rosa_rugosa	Rorug06G0007000 Rorug06G0007000 Rorug06G0007000
rosa_samantha	Rh6AG127900 Rh6BG123700 Rh6CG122400 Rh6DG109600
rosa_wichuraiana	Rw6G011040

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
Acc36I	ACCTGC	1 cut(s)	475
AccI	GTMKAC	1 cut(s)	380
AcsI	RAATTY	3 cut(s)	83, 173, 199
AcuI	CTGAAG	1 cut(s)	137
AfaI	GTAC	1 cut(s)	428
AfiI	CCNNNNNNNGG	2 cut(s)	221, 484
AgsI	TTSAA	4 cut(s)	113, 137, 156, 299
AjnI	CCWGG	1 cut(s)	54
AjuI	GAANNNNNNNTTGG	2 cut(s)	110, 142
AluBI	AGCT	3 cut(s)	133, 419, 449
AluI	AGCT	3 cut(s)	133, 419, 449
Alw26I	GTCTC	1 cut(s)	138
AoxI	GGCC	2 cut(s)	404, 413
ApoI	RAATTY	3 cut(s)	83, 173, 199
AseI	ATTAAT	1 cut(s)	167
Asp700I	GAANNNNTTC	1 cut(s)	83
AspS9I	GGNCC	2 cut(s)	181, 413
AsuC2I	CCSGG	1 cut(s)	99
AsuHPI	GGTGA	2 cut(s)	268, 412
AvaII	GGWCC	1 cut(s)	181
AxyI	CCTNAGG	1 cut(s)	408
BccI	CCATC	1 cut(s)	367
BciT130I	CCWGG	1 cut(s)	56
BcnI	CCSGG	1 cut(s)	99
BcoDI	GTCTC	1 cut(s)	138
BfaI	CTAG	1 cut(s)	305
BfuAI	ACCTGC	1 cut(s)	475
BglI	GCCNNNNNGGC	1 cut(s)	412
Bme1390I	CCNGG	2 cut(s)	56, 99
Bme18I	GGWCC	1 cut(s)	181
BmgT120I	GGNCC	2 cut(s)	181, 413
BmiI	GGNNCC	2 cut(s)	327, 414
BmrFI	CCNGG	2 cut(s)	56, 99
BmrI	ACTGGG	1 cut(s)	196
BmsI	GCATC	1 cut(s)	22
BmuI	ACTGGG	1 cut(s)	196
BpmI	CTGGAG	1 cut(s)	77
BpuMI	CCSGG	1 cut(s)	99
Bsc4I	CCNNNNNNNGG	2 cut(s)	221, 484
Bse1I	ACTGG	1 cut(s)	191
Bse21I	CCTNAGG	1 cut(s)	408
Bse3DI	GCAATG	2 cut(s)	430, 472
BseBI	CCWGG	1 cut(s)	56
BseLI	CCNNNNNNNGG	2 cut(s)	221, 484
BseMI	GCAATG	2 cut(s)	430, 472
BseMII	CTCAG	1 cut(s)	399
BseNI	ACTGG	1 cut(s)	191
BshFI	GGCC	2 cut(s)	406, 415
BsiSI	CCGG	1 cut(s)	98
BslI	CCNNNNNNNGG	2 cut(s)	221, 484
BsmAI	GTCTC	1 cut(s)	138
BsnI	GGCC	2 cut(s)	406, 415
Bsp143I	GATC	1 cut(s)	314
BspANI	GGCC	2 cut(s)	406, 415
BspCNI	CTCAG	1 cut(s)	400
BspLI	GGNNCC	2 cut(s)	327, 414
BspMI	ACCTGC	1 cut(s)	475
BsrDI	GCAATG	2 cut(s)	430, 472
BsrI	ACTGG	1 cut(s)	191
BssMI	GATC	1 cut(s)	314
Bst2UI	CCWGG	1 cut(s)	56
Bst4CI	ACNGT	3 cut(s)	232, 248, 355
BstC8I	GCNNGC	1 cut(s)	417
BstDEI	CTNAG	2 cut(s)	330, 408
BstKTI	GATC	1 cut(s)	317
BstMAI	GTCTC	1 cut(s)	138
BstMBI	GATC	1 cut(s)	314
BstMWI	GCNNNNNNNGC	2 cut(s)	412, 474
BstNI	CCWGG	1 cut(s)	56
BstSCI	CCNGG	2 cut(s)	54, 97
Bsu36I	CCTNAGG	1 cut(s)	408
BsuRI	GGCC	2 cut(s)	406, 415
BtsIMutI	CAGTG	3 cut(s)	184, 253, 327
BveI	ACCTGC	1 cut(s)	475
Cac8I	GCNNGC	1 cut(s)	417
Cfr13I	GGNCC	2 cut(s)	181, 413
Csp6I	GTAC	1 cut(s)	427
CviAII	CATG	1 cut(s)	89
CviJI	RGCY	5 cut(s)	133, 406, 415, 419, 449
CviKI_1	RGCY	5 cut(s)	133, 406, 415, 419, 449
CviQI	GTAC	1 cut(s)	427
DdeI	CTNAG	2 cut(s)	330, 408
DpnI	GATC	1 cut(s)	316
DpnII	GATC	1 cut(s)	314
Eco147I	AGGCCT	1 cut(s)	406
Eco47I	GGWCC	1 cut(s)	181
Eco57I	CTGAAG	1 cut(s)	137
Eco81I	CCTNAGG	1 cut(s)	408
EcoRII	CCWGG	1 cut(s)	54
FaeI	CATG	1 cut(s)	92
FaiI	YATR	5 cut(s)	52, 77, 90, 125, 500
FalI	AAGNNNNNCTT	4 cut(s)	256, 288, 323, 355
FatI	CATG	1 cut(s)	88
FblI	GTMKAC	1 cut(s)	380
FspBI	CTAG	1 cut(s)	305
GsuI	CTGGAG	1 cut(s)	77
HaeIII	GGCC	2 cut(s)	406, 415
HapII	CCGG	1 cut(s)	98
Hin1II	CATG	1 cut(s)	92
HincII	GTYRAC	1 cut(s)	244
HindII	GTYRAC	1 cut(s)	244
HinfI	GANTC	4 cut(s)	152, 269, 308, 377
HpaII	CCGG	1 cut(s)	98
HphI	GGTGA	2 cut(s)	268, 412
Hpy166II	GTNNAC	2 cut(s)	244, 381
Hpy188I	TCNGA	1 cut(s)	31
Hpy188III	TCNNGA	4 cut(s)	44, 156, 312, 508
Hpy8I	GTNNAC	2 cut(s)	244, 381
HpyAV	CCTTC	1 cut(s)	112
HpyCH4III	ACNGT	3 cut(s)	232, 248, 355
HpyCH4V	TGCA	3 cut(s)	92, 236, 435
HpyF10VI	GCNNNNNNNGC	2 cut(s)	412, 474
HpyF3I	CTNAG	2 cut(s)	330, 408
Hsp92II	CATG	1 cut(s)	92
Kzo9I	GATC	1 cut(s)	314
LmnI	GCTCC	1 cut(s)	130
LweI	GCATC	1 cut(s)	22
MaeI	CTAG	1 cut(s)	305
MaeIII	GTNAC	1 cut(s)	256
MalI	GATC	1 cut(s)	316
MboI	GATC	1 cut(s)	314
MfeI	CAATTG	1 cut(s)	67
MluCI	AATT	7 cut(s)	67, 83, 164, 173, 199, 395, 503
MlyI	GAGTC	1 cut(s)	386
MmeI	TCCRAC	2 cut(s)	108, 374
MnlI	CCTC	3 cut(s)	247, 396, 403
MroXI	GAANNNNTTC	1 cut(s)	83
MseI	TTAA	2 cut(s)	18, 167
MspA1I	CMGCKG	2 cut(s)	419, 449
MspI	CCGG	1 cut(s)	98
MspR9I	CCNGG	2 cut(s)	56, 99
MunI	CAATTG	1 cut(s)	67
MvaI	CCWGG	1 cut(s)	56
MwoI	GCNNNNNNNGC	2 cut(s)	412, 474
NciI	CCSGG	1 cut(s)	99
NdeII	GATC	1 cut(s)	314
NlaIII	CATG	1 cut(s)	92
NlaIV	GGNNCC	2 cut(s)	327, 414
NmuCI	GTSAC	1 cut(s)	256
PceI	AGGCCT	1 cut(s)	406
PdmI	GAANNNNTTC	1 cut(s)	83
PfeI	GAWTC	3 cut(s)	152, 269, 308
PfoI	TCCNGGA	1 cut(s)	97
PleI	GAGTC	1 cut(s)	385
PpsI	GAGTC	1 cut(s)	385
PshBI	ATTAAT	1 cut(s)	167
Psp6I	CCWGG	1 cut(s)	54
PspGI	CCWGG	1 cut(s)	54
PspN4I	GGNNCC	2 cut(s)	327, 414
PspPI	GGNCC	2 cut(s)	181, 413
PsrI	GAACNNNNNNTAC	2 cut(s)	31, 63
PvuII	CAGCTG	2 cut(s)	419, 449
RsaI	GTAC	1 cut(s)	428
RsaNI	GTAC	1 cut(s)	427
SaqAI	TTAA	2 cut(s)	18, 167
Sau3AI	GATC	1 cut(s)	314
Sau96I	GGNCC	2 cut(s)	181, 413
SchI	GAGTC	1 cut(s)	386
ScrFI	CCNGG	2 cut(s)	56, 99
SetI	ASST	7 cut(s)	57, 135, 226, 258, 421, 451, 489
SfaNI	GCATC	1 cut(s)	22
SfiI	GGCCNNNNNGGCC	1 cut(s)	412
SinI	GGWCC	1 cut(s)	181
Sse9I	AATT	7 cut(s)	67, 83, 164, 173, 199, 395, 503
SseBI	AGGCCT	1 cut(s)	406
SspMI	CTAG	1 cut(s)	305
StuI	AGGCCT	1 cut(s)	406
StyD4I	CCNGG	2 cut(s)	54, 97
TaaI	ACNGT	3 cut(s)	232, 248, 355
TaqI	TCGA	2 cut(s)	37, 150
TasI	AATT	7 cut(s)	67, 83, 164, 173, 199, 395, 503
TfiI	GAWTC	3 cut(s)	152, 269, 308
Tru1I	TTAA	2 cut(s)	18, 167
Tru9I	TTAA	2 cut(s)	18, 167
TscAI	CASTG	3 cut(s)	191, 253, 327
TseFI	GTSAC	1 cut(s)	256
Tsp45I	GTSAC	1 cut(s)	256
TspDTI	ATGAA	2 cut(s)	92, 506
TspRI	CASTG	3 cut(s)	191, 253, 327
VpaK11BI	GGWCC	1 cut(s)	181
VspI	ATTAAT	1 cut(s)	167
XapI	RAATTY	3 cut(s)	83, 173, 199
XmiI	GTMKAC	1 cut(s)	380
XmnI	GAANNNNTTC	1 cut(s)	83
XspI	CTAG	1 cut(s)	305

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.