Rmu_co8396839.1_g000001
ERF Family

Belongs to the TRAFAC class myosin-kinesin ATPase superfamily. Kinesin family

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co8396839.1
Physical Location & Seq
Reverse (-)
1 .. 1163
1163 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co8396839.1_g000001.1.cds

Sequence Viewer

Length: 481 bp
atgtatgatcttattgcctgggactgcctggatgagaacactattgttttcaagaatccaaatcatgagagacctgctaatccatacatatttgataaggtgtttggcccaacgtgctcaactcagaaggtctatgaagatggggctaaggatgttgctttatctgcacttacaggaatgaatgcaacaatttttgcatatgggcagactagtagtggaaagacattcaccatgagaggaatcactgaaaatgctgtcaaggacatttttgaacacatcaagaaaacaccagagaggaagttcattcttaagttttctgcattggagatttacaatgaaactgttgttgaccttctgaaacgcaaatctggccccgttcggcttttggatgatgctgagaaagggaccaatgtggataaattacatgaagaaattattgaagatggccaacatttgaaacatttgattggaatatgtgaag

Protein Analysis

160

Amino Acids

18.08

Weight (kDa)

5.56

Isoelectric Point (pI)

21.07

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc36I ACCTGC 1 cut(s) 82
AcoI YGGCCR 1 cut(s) 445
AflII CTTAAG 1 cut(s) 308
AgsI TTSAA 4 cut(s) 52, 272, 440, 457
AhlI ACTAGT 1 cut(s) 209
AjnI CCWGG 2 cut(s) 17, 27
Alw21I GWGCWC 1 cut(s) 119
Alw26I GTCTC 1 cut(s) 64
AoxI GGCC 3 cut(s) 106, 370, 445
AspS9I GGNCC 3 cut(s) 107, 371, 405
AsuHPI GGTGA 1 cut(s) 220
AvaII GGWCC 1 cut(s) 405
BalI TGGCCA 1 cut(s) 447
Bbv12I GWGCWC 1 cut(s) 119
BccI CCATC 2 cut(s) 134, 437
BciT130I CCWGG 2 cut(s) 19, 29
BcoDI GTCTC 1 cut(s) 64
BcuI ACTAGT 1 cut(s) 209
BfaI CTAG 1 cut(s) 210
BfrI CTTAAG 1 cut(s) 308
BfuAI ACCTGC 1 cut(s) 82
Bme1390I CCNGG 2 cut(s) 19, 29
Bme18I GGWCC 1 cut(s) 405
BmgT120I GGNCC 3 cut(s) 107, 371, 405
BmiI GGNNCC 2 cut(s) 373, 406
BmrFI CCNGG 2 cut(s) 19, 29
BmsI GCATC 1 cut(s) 382
Bpu10I CCTNAGC 1 cut(s) 147
BsaI GGTCTC 1 cut(s) 64
BsaJI CCNNGG 1 cut(s) 18
BseBI CCWGG 2 cut(s) 19, 29
BseDI CCNNGG 1 cut(s) 18
BseGI GGATG 3 cut(s) 37, 157, 394
BseMII CTCAG 2 cut(s) 137, 387
BsgI GTGCAG 1 cut(s) 150
BshFI GGCC 3 cut(s) 108, 372, 447
BsiHKAI GWGCWC 1 cut(s) 119
BslFI GGGAC 2 cut(s) 35, 418
BsmAI GTCTC 1 cut(s) 64
BsmFI GGGAC 2 cut(s) 35, 418
BsmI GAATGC 1 cut(s) 187
BsnI GGCC 3 cut(s) 108, 372, 447
Bso31I GGTCTC 1 cut(s) 64
Bsp1286I GDGCHC 1 cut(s) 119
Bsp143I GATC 1 cut(s) 7
BspANI GGCC 3 cut(s) 108, 372, 447
BspCNI CTCAG 2 cut(s) 136, 388
BspHI TCATGA 1 cut(s) 64
BspLI GGNNCC 2 cut(s) 373, 406
BspMI ACCTGC 1 cut(s) 82
BspTI CTTAAG 1 cut(s) 308
BspTNI GGTCTC 1 cut(s) 64
BssECI CCNNGG 1 cut(s) 18
BssMI GATC 1 cut(s) 7
Bst2UI CCWGG 2 cut(s) 19, 29
Bst4CI ACNGT 1 cut(s) 343
BstAFI CTTAAG 1 cut(s) 308
BstDEI CTNAG 3 cut(s) 123, 147, 396
BstF5I GGATG 3 cut(s) 37, 157, 394
BstKTI GATC 1 cut(s) 10
BstMAI GTCTC 1 cut(s) 64
BstMBI GATC 1 cut(s) 7
BstMWI GCNNNNNNNGC 3 cut(s) 114, 164, 369
BstNI CCWGG 2 cut(s) 19, 29
BstSCI CCNGG 2 cut(s) 17, 27
BsuRI GGCC 3 cut(s) 108, 372, 447
BtsCI GGATG 3 cut(s) 37, 157, 394
BtsIMutI CAGTG 1 cut(s) 243
BveI ACCTGC 1 cut(s) 82
CciI TCATGA 1 cut(s) 64
Cfr13I GGNCC 3 cut(s) 107, 371, 405
CviAII CATG 3 cut(s) 65, 232, 425
CviJI RGCY 5 cut(s) 108, 146, 372, 382, 447
CviKI_1 RGCY 5 cut(s) 108, 146, 372, 382, 447
DdeI CTNAG 3 cut(s) 123, 147, 396
DpnI GATC 1 cut(s) 9
DpnII GATC 1 cut(s) 7
EaeI YGGCCR 1 cut(s) 445
Eco31I GGTCTC 1 cut(s) 64
Eco47I GGWCC 1 cut(s) 405
EcoRII CCWGG 2 cut(s) 17, 27
FaeI CATG 3 cut(s) 68, 235, 428
FaqI GGGAC 2 cut(s) 35, 418
FatI CATG 3 cut(s) 64, 231, 424
FauNDI CATATG 1 cut(s) 199
FokI GGATG 3 cut(s) 44, 164, 401
FspBI CTAG 1 cut(s) 210
HaeIII GGCC 3 cut(s) 108, 372, 447
Hin1II CATG 3 cut(s) 68, 235, 428
HincII GTYRAC 1 cut(s) 349
HindII GTYRAC 1 cut(s) 349
HinfI GANTC 2 cut(s) 55, 240
HphI GGTGA 1 cut(s) 220
Hpy166II GTNNAC 1 cut(s) 349
Hpy188I TCNGA 2 cut(s) 126, 357
Hpy188III TCNNGA 3 cut(s) 52, 65, 280
Hpy8I GTNNAC 1 cut(s) 349
HpyAV CCTTC 2 cut(s) 121, 362
HpyCH4III ACNGT 1 cut(s) 343
HpyCH4IV ACGT 1 cut(s) 113
HpyCH4V TGCA 4 cut(s) 167, 185, 197, 320
HpyF10VI GCNNNNNNNGC 3 cut(s) 114, 164, 369
HpyF3I CTNAG 3 cut(s) 123, 147, 396
HpySE526I ACGT 1 cut(s) 113
Hsp92II CATG 3 cut(s) 68, 235, 428
Kzo9I GATC 1 cut(s) 7
LpnPI CCDG 8 cut(s) 4, 14, 31, 41, 87, 159, 303, 354
LweI GCATC 1 cut(s) 382
MaeI CTAG 1 cut(s) 210
MaeII ACGT 1 cut(s) 113
MalI GATC 1 cut(s) 9
MboI GATC 1 cut(s) 7
MboII GAAGA 3 cut(s) 149, 440, 452
MhlI GDGCHC 1 cut(s) 119
MlsI TGGCCA 1 cut(s) 447
MluCI AATT 3 cut(s) 189, 419, 432
MluNI TGGCCA 1 cut(s) 447
MnlI CCTC 2 cut(s) 230, 288
Mox20I TGGCCA 1 cut(s) 447
MscI TGGCCA 1 cut(s) 447
MseI TTAA 1 cut(s) 309
Msp20I TGGCCA 1 cut(s) 447
MspCI CTTAAG 1 cut(s) 308
MspR9I CCNGG 2 cut(s) 19, 29
Mva1269I GAATGC 1 cut(s) 187
MvaI CCWGG 2 cut(s) 19, 29
MwoI GCNNNNNNNGC 3 cut(s) 114, 164, 369
NdeI CATATG 1 cut(s) 199
NdeII GATC 1 cut(s) 7
NlaIII CATG 3 cut(s) 68, 235, 428
NlaIV GGNNCC 2 cut(s) 373, 406
PagI TCATGA 1 cut(s) 64
PctI GAATGC 1 cut(s) 187
PfeI GAWTC 2 cut(s) 55, 240
Psp6I CCWGG 2 cut(s) 17, 27
PspGI CCWGG 2 cut(s) 17, 27
PspN4I GGNNCC 2 cut(s) 373, 406
PspPI GGNCC 3 cut(s) 107, 371, 405
SaqAI TTAA 1 cut(s) 309
Sau3AI GATC 1 cut(s) 7
Sau96I GGNCC 3 cut(s) 107, 371, 405
ScrFI CCNGG 2 cut(s) 19, 29
SduI GDGCHC 1 cut(s) 119
SetI ASST 5 cut(s) 76, 102, 116, 132, 354
SfaNI GCATC 1 cut(s) 382
SinI GGWCC 1 cut(s) 405
SmlI CTYRAG 1 cut(s) 308
SmoI CTYRAG 1 cut(s) 308
SpeI ACTAGT 1 cut(s) 209
Sse9I AATT 3 cut(s) 189, 419, 432
SspMI CTAG 1 cut(s) 210
StyD4I CCNGG 2 cut(s) 17, 27
TaaI ACNGT 1 cut(s) 343
TaiI ACGT 1 cut(s) 116
TasI AATT 3 cut(s) 189, 419, 432
TfiI GAWTC 2 cut(s) 55, 240
Tru1I TTAA 1 cut(s) 309
Tru9I TTAA 1 cut(s) 309
TscAI CASTG 1 cut(s) 250
TspDTI ATGAA 5 cut(s) 150, 194, 292, 351, 441
TspRI CASTG 1 cut(s) 250
Vha464I CTTAAG 1 cut(s) 308
VpaK11BI GGWCC 1 cut(s) 405
XspI CTAG 1 cut(s) 210
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.