Rmu_co8413877.1_g000001

Methyltransferase-like protein

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co8413877.1
Physical Location & Seq
Forward (+)
1 .. 1097
1097 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co8413877.1_g000001.1.cds

Sequence Viewer

Length: 357 bp
ttggacatagattatattcaatgcaacatcaagaacttagggtggagagctgaagttgttgatactattgtaatgaatcctccatttggaactcggaaaaagggtgctgacatggattttctctctgtggctttgaaggttgcttctcaagctgtttattccttacataaaacctccacgagagatcatgtgaaaagggcagccttgcagcaattcaatgctagcagtgctgaggttatatgtgagcttcgatatgatttaccacaaacgtacaagtttcataagaaacgagaggtggatatcgctgtggacttgtggcgatttgtccccaagagtaagcagggtccagagatctag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

118

Amino Acids

13.51

Weight (kDa)

9.15

Isoelectric Point (pI)

36.26

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcuI CTGAAG 1 cut(s) 72
AfaI GTAC 1 cut(s) 272
AfiI CCNNNNNNNGG 1 cut(s) 86
AgsI TTSAA 3 cut(s) 20, 136, 217
AluBI AGCT 3 cut(s) 50, 152, 247
AluI AGCT 3 cut(s) 50, 152, 247
ApeKI GCWGC 2 cut(s) 200, 208
AspS9I GGNCC 1 cut(s) 344
AsuNHI GCTAGC 1 cut(s) 221
AvaII GGWCC 1 cut(s) 344
BaeI ACNNNNGTAYC 2 cut(s) 54, 87
BauI CACGAG 1 cut(s) 178
BbvCI CCTCAGC 1 cut(s) 231
BbvI GCAGC 2 cut(s) 212, 220
BfaI CTAG 2 cut(s) 222, 355
BglII AGATCT 1 cut(s) 351
BisI GCNGC 2 cut(s) 201, 209
BlsI GCNGC 2 cut(s) 202, 210
Bme18I GGWCC 1 cut(s) 344
BmgT120I GGNCC 1 cut(s) 344
BmiI GGNNCC 1 cut(s) 345
BmtI GCTAGC 1 cut(s) 225
Bpu10I CCTNAGC 1 cut(s) 231
BpuEI CTTGAG 1 cut(s) 132
Bsc4I CCNNNNNNNGG 1 cut(s) 86
BseLI CCNNNNNNNGG 1 cut(s) 86
BseMII CTCAG 1 cut(s) 222
BseXI GCAGC 2 cut(s) 212, 220
BslFI GGGAC 1 cut(s) 311
BslI CCNNNNNNNGG 1 cut(s) 86
BsmFI GGGAC 1 cut(s) 311
Bsp143I GATC 2 cut(s) 184, 351
BspCNI CTCAG 1 cut(s) 223
BspLI GGNNCC 1 cut(s) 345
BspOI GCTAGC 1 cut(s) 225
BssMI GATC 2 cut(s) 184, 351
BssSI CACGAG 1 cut(s) 178
Bst2BI CACGAG 1 cut(s) 178
BstC8I GCNNGC 1 cut(s) 223
BstDEI CTNAG 2 cut(s) 37, 231
BstKTI GATC 2 cut(s) 187, 354
BstMBI GATC 2 cut(s) 184, 351
BstMWI GCNNNNNNNGC 2 cut(s) 149, 227
BstV1I GCAGC 2 cut(s) 212, 220
BstX2I RGATCY 1 cut(s) 351
BstYI RGATCY 1 cut(s) 351
BtsI GCAGTG 1 cut(s) 232
BtsIMutI CAGTG 1 cut(s) 232
Cac8I GCNNGC 1 cut(s) 223
Cfr13I GGNCC 1 cut(s) 344
Csp6I GTAC 1 cut(s) 271
CviAII CATG 2 cut(s) 112, 188
CviJI RGCY 5 cut(s) 50, 131, 152, 203, 247
CviKI_1 RGCY 5 cut(s) 50, 131, 152, 203, 247
CviQI GTAC 1 cut(s) 271
DdeI CTNAG 2 cut(s) 37, 231
DpnI GATC 2 cut(s) 186, 353
DpnII GATC 2 cut(s) 184, 351
Eco32I GATATC 1 cut(s) 301
Eco47I GGWCC 1 cut(s) 344
Eco57I CTGAAG 1 cut(s) 72
EcoRV GATATC 1 cut(s) 301
FaeI CATG 2 cut(s) 115, 191
FaiI YATR 9 cut(s) 8, 15, 113, 168, 189, 239, 241, 255, 282
FaqI GGGAC 1 cut(s) 311
FatI CATG 2 cut(s) 111, 187
Fnu4HI GCNGC 2 cut(s) 201, 209
Fsp4HI GCNGC 2 cut(s) 201, 209
FspBI CTAG 2 cut(s) 222, 355
GluI GCNGC 2 cut(s) 201, 209
Hin1II CATG 2 cut(s) 115, 191
HinfI GANTC 1 cut(s) 76
Hpy166II GTNNAC 1 cut(s) 310
Hpy188I TCNGA 1 cut(s) 96
Hpy188III TCNNGA 2 cut(s) 31, 347
Hpy8I GTNNAC 1 cut(s) 310
HpyAV CCTTC 1 cut(s) 130
HpyCH4IV ACGT 1 cut(s) 269
HpyCH4V TGCA 2 cut(s) 24, 208
HpyF10VI GCNNNNNNNGC 2 cut(s) 149, 227
HpyF3I CTNAG 2 cut(s) 37, 231
HpySE526I ACGT 1 cut(s) 269
Hsp92II CATG 2 cut(s) 115, 191
Kzo9I GATC 2 cut(s) 184, 351
LpnPI CCDG 1 cut(s) 326
Lsp1109I GCAGC 2 cut(s) 212, 220
MaeI CTAG 2 cut(s) 222, 355
MaeII ACGT 1 cut(s) 269
MalI GATC 2 cut(s) 186, 353
MboI GATC 2 cut(s) 184, 351
MflI RGATCY 1 cut(s) 351
MluCI AATT 1 cut(s) 212
MnlI CCTC 4 cut(s) 90, 184, 226, 286
MwoI GCNNNNNNNGC 2 cut(s) 149, 227
NdeII GATC 2 cut(s) 184, 351
NheI GCTAGC 1 cut(s) 221
NlaIII CATG 2 cut(s) 115, 191
NlaIV GGNNCC 1 cut(s) 345
PfeI GAWTC 1 cut(s) 76
PkrI GCNGC 2 cut(s) 202, 210
PspN4I GGNNCC 1 cut(s) 345
PspPI GGNCC 1 cut(s) 344
PsuI RGATCY 1 cut(s) 351
RsaI GTAC 1 cut(s) 272
RsaNI GTAC 1 cut(s) 271
SatI GCNGC 2 cut(s) 201, 209
Sau3AI GATC 2 cut(s) 184, 351
Sau96I GGNCC 1 cut(s) 344
SetI ASST 8 cut(s) 52, 141, 154, 176, 237, 249, 272, 297
SinI GGWCC 1 cut(s) 344
SmlI CTYRAG 1 cut(s) 147
SmoI CTYRAG 1 cut(s) 147
Sse9I AATT 1 cut(s) 212
SspMI CTAG 2 cut(s) 222, 355
TaiI ACGT 1 cut(s) 272
TaqI TCGA 1 cut(s) 250
TasI AATT 1 cut(s) 212
TfiI GAWTC 1 cut(s) 76
TscAI CASTG 1 cut(s) 232
TseI GCWGC 2 cut(s) 200, 208
TspDTI ATGAA 2 cut(s) 89, 269
TspRI CASTG 1 cut(s) 232
VpaK11BI GGWCC 1 cut(s) 344
XspI CTAG 2 cut(s) 222, 355
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.