Rmu_sc0002270.1_g000030

Methyltransferase-like protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0002270.1
OG0008537
Physical Location & Seq
Forward (+)
119471 .. 122707
3237 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0002270.1_g000030.1.cds

Sequence Viewer

Length: 927 bp
atggggcttgggcccgacccgaaatttccaacccgtcccagttatgaaagaaaggggcagttggaactaaaccttggcagattcttgactctgggtgtttcgtcagggactctcgggatgaagctcaagcagctcgaaagcctccttggtggtctccaacagttctccaacccaaaggtggagctggaacaatacccaactggaccccacattgcatctcgcatgctctacactgcagagaattcatttggggatgtgtgtgacaaggtagtggctgattttggctgtggttgtggtacattgggggttgcagctggactcttgggcgcagaacatgtgattggcattgacgtcgatccagaatctcttgaattagcttcactaaatgctgaggaacttgaggcagagaattcatttggggatgtgtgtgacaaggtagtggctgattttggctgtggttgtggtacattgggggttgcagctggactcttgggcgcagaacatgtgattggcattgacgtcgatccagaatctcttgaattagcttcactaaatgctgaggaacttgagttggacatagattatattcaatgcaacatcaagaacttagggtggagagctgaagttgttgatactattgtaatgaatcctccatttggaactcggaaaaagggtgctgacatggattttctctctgtggctttgaaggttgcttctcaagctgtttattccttacataaaacctccacgagagatcatgtgaaaagggcagccttgcagcaattcaatgctagcagtgctgaggttatatgtgagcttcgatatgatttaccacaaacgtacaagtttcataagaaacgagaggtggatatcgctgtggacttgtggcgatttgtccccaagagtaagcagggtccagagatctag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
MTS PrmA

Protein Analysis

308

Amino Acids

33.32

Weight (kDa)

4.86

Isoelectric Point (pI)

26.6

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AatII GACGTC 2 cut(s) 354, 522
AclWI GGATC 2 cut(s) 350, 518
AcsI RAATTY 3 cut(s) 23, 241, 409
AcuI CTGAAG 1 cut(s) 642
AcyI GRCGYC 2 cut(s) 351, 519
AfaI GTAC 3 cut(s) 298, 466, 842
AfiI CCNNNNNNNGG 2 cut(s) 178, 656
AflIII ACRYGT 2 cut(s) 334, 502
AgsI TTSAA 5 cut(s) 371, 539, 590, 706, 787
AjuI GAANNNNNNNTTGG 8 cut(s) 57, 89, 129, 161, 324, 356, 492, 524
Alw26I GTCTC 1 cut(s) 158
AlwI GGATC 2 cut(s) 350, 518
Ama87I CYCGRG 1 cut(s) 113
AoxI GGCC 1 cut(s) 11
ApaI GGGCCC 1 cut(s) 15
ApeKI GCWGC 5 cut(s) 130, 311, 479, 770, 778
ApoI RAATTY 3 cut(s) 23, 241, 409
AspLEI GCGC 2 cut(s) 329, 497
AspS9I GGNCC 4 cut(s) 11, 12, 203, 914
AsuNHI GCTAGC 1 cut(s) 791
AvaI CYCGRG 1 cut(s) 113
AvaII GGWCC 2 cut(s) 203, 914
BaeGI GKGCMC 1 cut(s) 15
BaeI ACNNNNGTAYC 2 cut(s) 624, 657
BanII GRGCYC 1 cut(s) 15
BauI CACGAG 1 cut(s) 748
BbvCI CCTCAGC 3 cut(s) 390, 558, 801
BbvI GCAGC 5 cut(s) 142, 323, 491, 782, 790
BcgI CGANNNNNNTGC 4 cut(s) 334, 368, 502, 536
BcoDI GTCTC 1 cut(s) 158
BfaI CTAG 2 cut(s) 792, 925
BfmI CTRYAG 1 cut(s) 234
BglII AGATCT 1 cut(s) 921
BisI GCNGC 5 cut(s) 131, 312, 480, 771, 779
BlsI GCNGC 5 cut(s) 132, 313, 481, 772, 780
Bme18I GGWCC 2 cut(s) 203, 914
BmeT110I CYCGRG 1 cut(s) 113
BmgT120I GGNCC 4 cut(s) 11, 12, 203, 914
BmiI GGNNCC 3 cut(s) 13, 205, 915
BmrI ACTGGG 1 cut(s) 33
BmsI GCATC 1 cut(s) 224
BmtI GCTAGC 1 cut(s) 795
BmuI ACTGGG 1 cut(s) 33
Bpu10I CCTNAGC 3 cut(s) 390, 558, 801
BpuEI CTTGAG 4 cut(s) 110, 419, 587, 702
BsaHI GRCGYC 2 cut(s) 351, 519
BsaI GGTCTC 1 cut(s) 158
BsaJI CCNNGG 2 cut(s) 73, 145
Bsc4I CCNNNNNNNGG 2 cut(s) 178, 656
Bse1I ACTGG 2 cut(s) 39, 205
Bse3DI GCAATG 1 cut(s) 210
BseDI CCNNGG 2 cut(s) 73, 145
BseGI GGATG 3 cut(s) 123, 259, 427
BseLI CCNNNNNNNGG 2 cut(s) 178, 656
BseMI GCAATG 1 cut(s) 210
BseMII CTCAG 3 cut(s) 381, 549, 792
BseNI ACTGG 2 cut(s) 39, 205
BseSI GKGCMC 1 cut(s) 15
BseXI GCAGC 5 cut(s) 142, 323, 491, 782, 790
BshFI GGCC 1 cut(s) 13
BsiHKCI CYCGRG 1 cut(s) 113
BslFI GGGAC 3 cut(s) 21, 121, 881
BslI CCNNNNNNNGG 2 cut(s) 178, 656
BsmAI GTCTC 1 cut(s) 158
BsmFI GGGAC 3 cut(s) 21, 121, 881
BsnI GGCC 1 cut(s) 13
Bso31I GGTCTC 1 cut(s) 158
BsoBI CYCGRG 1 cut(s) 113
Bsp120I GGGCCC 1 cut(s) 11
Bsp1286I GDGCHC 1 cut(s) 15
Bsp143I GATC 4 cut(s) 355, 523, 754, 921
BspANI GGCC 1 cut(s) 13
BspCNI CTCAG 3 cut(s) 382, 550, 793
BspLI GGNNCC 3 cut(s) 13, 205, 915
BspMAI CTGCAG 1 cut(s) 238
BspOI GCTAGC 1 cut(s) 795
BspPI GGATC 2 cut(s) 350, 518
BspTNI GGTCTC 1 cut(s) 158
BsrDI GCAATG 1 cut(s) 210
BsrI ACTGG 2 cut(s) 39, 205
BssECI CCNNGG 2 cut(s) 73, 145
BssMI GATC 4 cut(s) 355, 523, 754, 921
BssNI GRCGYC 2 cut(s) 351, 519
BssSI CACGAG 1 cut(s) 748
BssT1I CCWWGG 2 cut(s) 73, 145
Bst2BI CACGAG 1 cut(s) 748
Bst4CI ACNGT 1 cut(s) 162
BstACI GRCGYC 2 cut(s) 351, 519
BstC8I GCNNGC 2 cut(s) 224, 793
BstDEI CTNAG 4 cut(s) 390, 558, 607, 801
BstF5I GGATG 3 cut(s) 123, 259, 427
BstHHI GCGC 2 cut(s) 329, 497
BstKTI GATC 4 cut(s) 358, 526, 757, 924
BstMAI GTCTC 1 cut(s) 158
BstMBI GATC 4 cut(s) 355, 523, 754, 921
BstMWI GCNNNNNNNGC 3 cut(s) 130, 719, 797
BstNSI RCATGY 3 cut(s) 226, 338, 506
BstSFI CTRYAG 1 cut(s) 234
BstSLI GKGCMC 1 cut(s) 15
BstV1I GCAGC 5 cut(s) 142, 323, 491, 782, 790
BstX2I RGATCY 1 cut(s) 921
BstYI RGATCY 1 cut(s) 921
BsuRI GGCC 1 cut(s) 13
BtsCI GGATG 3 cut(s) 123, 259, 427
BtsI GCAGTG 2 cut(s) 231, 802
BtsIMutI CAGTG 2 cut(s) 231, 802
Cac8I GCNNGC 2 cut(s) 224, 793
CfoI GCGC 2 cut(s) 329, 497
Cfr13I GGNCC 4 cut(s) 11, 12, 203, 914
Csp6I GTAC 3 cut(s) 297, 465, 841
CviAII CATG 5 cut(s) 223, 335, 503, 682, 758
CviQI GTAC 3 cut(s) 297, 465, 841
DdeI CTNAG 4 cut(s) 390, 558, 607, 801
DpnI GATC 4 cut(s) 357, 525, 756, 923
DpnII GATC 4 cut(s) 355, 523, 754, 921
Eco130I CCWWGG 2 cut(s) 73, 145
Eco24I GRGCYC 1 cut(s) 15
Eco31I GGTCTC 1 cut(s) 158
Eco32I GATATC 1 cut(s) 871
Eco47I GGWCC 2 cut(s) 203, 914
Eco57I CTGAAG 1 cut(s) 642
Eco88I CYCGRG 1 cut(s) 113
EcoRI GAATTC 2 cut(s) 241, 409
EcoRV GATATC 1 cut(s) 871
EcoT14I CCWWGG 2 cut(s) 73, 145
EcoT38I GRGCYC 1 cut(s) 15
ErhI CCWWGG 2 cut(s) 73, 145
FaeI CATG 5 cut(s) 226, 338, 506, 685, 761
FaqI GGGAC 3 cut(s) 21, 121, 881
FatI CATG 5 cut(s) 222, 334, 502, 681, 757
Fnu4HI GCNGC 5 cut(s) 131, 312, 480, 771, 779
FokI GGATG 3 cut(s) 130, 266, 434
FriOI GRGCYC 1 cut(s) 15
Fsp4HI GCNGC 5 cut(s) 131, 312, 480, 771, 779
FspBI CTAG 2 cut(s) 792, 925
GlaI GCGC 2 cut(s) 328, 496
GluI GCNGC 5 cut(s) 131, 312, 480, 771, 779
HaeIII GGCC 1 cut(s) 13
HhaI GCGC 2 cut(s) 329, 497
Hin1I GRCGYC 2 cut(s) 351, 519
Hin1II CATG 5 cut(s) 226, 338, 506, 685, 761
Hin6I GCGC 2 cut(s) 327, 495
HinP1I GCGC 2 cut(s) 327, 495
HinfI GANTC 8 cut(s) 81, 88, 109, 318, 362, 486, 530, 646
Hpy166II GTNNAC 1 cut(s) 880
Hpy188I TCNGA 1 cut(s) 666
Hpy188III TCNNGA 8 cut(s) 85, 115, 359, 368, 527, 536, 601, 917
Hpy8I GTNNAC 1 cut(s) 880
Hpy99I CGWCG 2 cut(s) 356, 524
HpyAV CCTTC 1 cut(s) 700
HpyCH4III ACNGT 1 cut(s) 162
HpyCH4IV ACGT 3 cut(s) 351, 519, 839
HpyCH4V TGCA 6 cut(s) 215, 236, 311, 479, 594, 778
HpyF10VI GCNNNNNNNGC 3 cut(s) 130, 719, 797
HpyF3I CTNAG 4 cut(s) 390, 558, 607, 801
HpySE526I ACGT 3 cut(s) 351, 519, 839
Hsp92I GRCGYC 2 cut(s) 351, 519
Hsp92II CATG 5 cut(s) 226, 338, 506, 685, 761
HspAI GCGC 2 cut(s) 327, 495
Kzo9I GATC 4 cut(s) 355, 523, 754, 921
LmnI GCTCC 1 cut(s) 181
Lsp1109I GCAGC 5 cut(s) 142, 323, 491, 782, 790
LweI GCATC 1 cut(s) 224
MaeI CTAG 2 cut(s) 792, 925
MaeII ACGT 3 cut(s) 351, 519, 839
MaeIII GTNAC 2 cut(s) 260, 428
MalI GATC 4 cut(s) 357, 525, 756, 923
MboI GATC 4 cut(s) 355, 523, 754, 921
MflI RGATCY 1 cut(s) 921
MhlI GDGCHC 1 cut(s) 15
MluCI AATT 6 cut(s) 23, 241, 371, 409, 539, 782
MlyI GAGTC 4 cut(s) 82, 103, 312, 480
MmeI TCCRAC 5 cut(s) 42, 53, 181, 192, 552
MnlI CCTC 8 cut(s) 152, 385, 394, 553, 660, 754, 796, 856
MspA1I CMGCKG 2 cut(s) 314, 482
MwoI GCNNNNNNNGC 3 cut(s) 130, 719, 797
NdeII GATC 4 cut(s) 355, 523, 754, 921
NheI GCTAGC 1 cut(s) 791
NlaIII CATG 5 cut(s) 226, 338, 506, 685, 761
NlaIV GGNNCC 3 cut(s) 13, 205, 915
NmuCI GTSAC 2 cut(s) 260, 428
NspI RCATGY 3 cut(s) 226, 338, 506
PaeI GCATGC 1 cut(s) 226
PciI ACATGT 2 cut(s) 334, 502
PfeI GAWTC 4 cut(s) 81, 362, 530, 646
PkrI GCNGC 5 cut(s) 132, 313, 481, 772, 780
PleI GAGTC 4 cut(s) 82, 103, 312, 480
PpsI GAGTC 4 cut(s) 82, 103, 312, 480
PscI ACATGT 2 cut(s) 334, 502
PspN4I GGNNCC 3 cut(s) 13, 205, 915
PspOMI GGGCCC 1 cut(s) 11
PspPI GGNCC 4 cut(s) 11, 12, 203, 914
PstI CTGCAG 1 cut(s) 238
PsuI RGATCY 1 cut(s) 921
PvuII CAGCTG 2 cut(s) 314, 482
RsaI GTAC 3 cut(s) 298, 466, 842
RsaNI GTAC 3 cut(s) 297, 465, 841
SatI GCNGC 5 cut(s) 131, 312, 480, 771, 779
Sau3AI GATC 4 cut(s) 355, 523, 754, 921
Sau96I GGNCC 4 cut(s) 11, 12, 203, 914
SchI GAGTC 4 cut(s) 82, 103, 312, 480
SduI GDGCHC 1 cut(s) 15
SfaNI GCATC 1 cut(s) 224
SfcI CTRYAG 1 cut(s) 234
SinI GGWCC 2 cut(s) 203, 914
SmlI CTYRAG 4 cut(s) 125, 398, 566, 717
SmoI CTYRAG 4 cut(s) 125, 398, 566, 717
SphI GCATGC 1 cut(s) 226
Sse9I AATT 6 cut(s) 23, 241, 371, 409, 539, 782
SspMI CTAG 2 cut(s) 792, 925
StyI CCWWGG 2 cut(s) 73, 145
TaaI ACNGT 1 cut(s) 162
TaiI ACGT 3 cut(s) 354, 522, 842
TaqI TCGA 4 cut(s) 135, 354, 522, 820
TasI AATT 6 cut(s) 23, 241, 371, 409, 539, 782
TfiI GAWTC 4 cut(s) 81, 362, 530, 646
TscAI CASTG 2 cut(s) 238, 802
TseFI GTSAC 2 cut(s) 260, 428
TseI GCWGC 5 cut(s) 130, 311, 479, 770, 778
Tsp45I GTSAC 2 cut(s) 260, 428
TspDTI ATGAA 6 cut(s) 60, 134, 234, 402, 659, 839
TspRI CASTG 2 cut(s) 238, 802
VpaK11BI GGWCC 2 cut(s) 203, 914
XapI RAATTY 3 cut(s) 23, 241, 409
XceI RCATGY 3 cut(s) 226, 338, 506
XcmI CCANNNNNNNNNTGG 1 cut(s) 175
XspI CTAG 2 cut(s) 792, 925
ZraI GACGTC 2 cut(s) 352, 520
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.