Rmu_co8419219.1_g000001

membrane

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co8419219.1
Physical Location & Seq
Reverse (-)
1 .. 1367
1367 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co8419219.1_g000001.1.cds

Sequence Viewer

Length: 924 bp
atgcacatgtttggcaattgcaggattgatagatttgatgtaccacttaaagttgcaatattgtttggcttgcctgccctgtttggtatctggctgggtttaagcataactgggagtgttcttgtgggattgggctatgggtttttcactccttgggtttctacttttgaggcttttaggcatggcaatgagttgaagaagttcaaacattgtgttattgatggaacttggggaactgttaaaggaagctgtactgtagttagagactttgcagacatatgttaccactcgtacccactctacttgaaggagttgcgtgaatcccctgcttcagaagaagttaaaactctaaggttgattcatgtaccagcatgtatactagttggtgtgttggggctaatggtggagattcctctttacactgcaattgctgttgtgaagagtccatatatgctgtttaagggctggtatcgactgattcatgatctgattagtcgagaaggaccatttcttgaagtagcttgcatccctattgctggtttgacaatcctcatgtggccaattgtggttgttggaagcatcttactgacagttgtctccagcatttttgttggattatatgcagcagtggtagtatatcaggaaagatctttcaagagaggtgtgacttacgtgattgcaatggttgctgagtttgatgagtacacaaatgactggttatatcttcgagagggcaccatatttccgaagccccattatcgaaaaaaagttgtttctcaaccatcagagctttccgtccgaggaaggctggcagctggaggtaagctcagttttgctccaatggaggcacctgcaatgcatatgccaagtgtggccaattcaagatcagttagagaggctatacatgaagtaaaaatggtacag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

308

Amino Acids

34.44

Weight (kDa)

8.94

Isoelectric Point (pI)

42.08

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AarI CACCTGC 1 cut(s) 859
Acc36I ACCTGC 1 cut(s) 859
AccB1I GGYRCC 2 cut(s) 734, 847
AccI GTMKAC 1 cut(s) 376
AcoI YGGCCR 2 cut(s) 557, 873
AcuI CTGAAG 1 cut(s) 315
AfaI GTAC 6 cut(s) 42, 253, 293, 366, 704, 921
AfiI CCNNNNNNNGG 1 cut(s) 536
AflIII ACRYGT 1 cut(s) 6
AgsI TTSAA 6 cut(s) 196, 205, 307, 515, 655, 882
AhlI ACTAGT 1 cut(s) 379
AluBI AGCT 5 cut(s) 249, 521, 790, 815, 826
AluI AGCT 5 cut(s) 249, 521, 790, 815, 826
Alw26I GTCTC 2 cut(s) 258, 601
AoxI GGCC 2 cut(s) 557, 873
ApeKI GCWGC 2 cut(s) 623, 812
Asp700I GAANNNNTTC 1 cut(s) 200
AspS9I GGNCC 1 cut(s) 503
AvaII GGWCC 1 cut(s) 503
BaeGI GKGCMC 1 cut(s) 737
BalI TGGCCA 2 cut(s) 559, 875
BanI GGYRCC 2 cut(s) 734, 847
BbvI GCAGC 2 cut(s) 635, 824
BccI CCATC 2 cut(s) 215, 790
BcoDI GTCTC 2 cut(s) 258, 601
BcuI ACTAGT 1 cut(s) 379
BfaI CTAG 1 cut(s) 380
BfmI CTRYAG 1 cut(s) 255
BfuAI ACCTGC 1 cut(s) 859
BglII AGATCT 1 cut(s) 647
BisI GCNGC 2 cut(s) 624, 813
BlsI GCNGC 2 cut(s) 625, 814
Bme18I GGWCC 1 cut(s) 503
BmgT120I GGNCC 1 cut(s) 503
BmiI GGNNCC 2 cut(s) 736, 849
BmrI ACTGGG 1 cut(s) 120
BmsI GCATC 2 cut(s) 534, 588
BmuI ACTGGG 1 cut(s) 120
BoxI GACNNNNGTC 1 cut(s) 593
BplI GAGNNNNNCTC 2 cut(s) 810, 842
BpmI CTGGAG 2 cut(s) 583, 837
BsaAI YACGTR 1 cut(s) 673
BsaJI CCNNGG 2 cut(s) 152, 799
Bsc4I CCNNNNNNNGG 1 cut(s) 536
Bse1I ACTGG 2 cut(s) 115, 719
Bse3DI GCAATG 3 cut(s) 193, 687, 861
BseDI CCNNGG 2 cut(s) 152, 799
BseGI GGATG 1 cut(s) 525
BseLI CCNNNNNNNGG 1 cut(s) 536
BseMI GCAATG 3 cut(s) 193, 687, 861
BseMII CTCAG 2 cut(s) 681, 841
BseNI ACTGG 2 cut(s) 115, 719
BseSI GKGCMC 1 cut(s) 737
BseXI GCAGC 2 cut(s) 635, 824
BseYI CCCAGC 1 cut(s) 94
BshFI GGCC 2 cut(s) 559, 875
BshNI GGYRCC 2 cut(s) 734, 847
BslI CCNNNNNNNGG 1 cut(s) 536
BsmAI GTCTC 2 cut(s) 258, 601
BsnI GGCC 2 cut(s) 559, 875
Bsp1286I GDGCHC 1 cut(s) 737
Bsp143I GATC 3 cut(s) 484, 647, 884
BspANI GGCC 2 cut(s) 559, 875
BspCNI CTCAG 2 cut(s) 682, 840
BspHI TCATGA 1 cut(s) 481
BspLI GGNNCC 2 cut(s) 736, 849
BspMI ACCTGC 1 cut(s) 859
BspT107I GGYRCC 2 cut(s) 734, 847
BsrDI GCAATG 3 cut(s) 193, 687, 861
BsrI ACTGG 2 cut(s) 115, 719
BssECI CCNNGG 2 cut(s) 152, 799
BssMI GATC 3 cut(s) 484, 647, 884
BssNAI GTATAC 1 cut(s) 377
BssT1I CCWWGG 1 cut(s) 152
Bst1107I GTATAC 1 cut(s) 377
Bst4CI ACNGT 3 cut(s) 238, 256, 592
Bst6I CTCTTC 1 cut(s) 434
BstAPI GCANNNNNTGC 1 cut(s) 686
BstBAI YACGTR 1 cut(s) 673
BstC8I GCNNGC 4 cut(s) 71, 75, 523, 810
BstDEI CTNAG 3 cut(s) 350, 690, 827
BstF5I GGATG 1 cut(s) 525
BstKTI GATC 3 cut(s) 487, 650, 887
BstMAI GTCTC 2 cut(s) 258, 601
BstMBI GATC 3 cut(s) 484, 647, 884
BstMWI GCNNNNNNNGC 1 cut(s) 686
BstNSI RCATGY 2 cut(s) 10, 375
BstPAI GACNNNNGTC 1 cut(s) 593
BstSFI CTRYAG 1 cut(s) 255
BstSLI GKGCMC 1 cut(s) 737
BstV1I GCAGC 2 cut(s) 635, 824
BstX2I RGATCY 1 cut(s) 647
BstYI RGATCY 1 cut(s) 647
BstZ17I GTATAC 1 cut(s) 377
BsuRI GGCC 2 cut(s) 559, 875
BtsCI GGATG 1 cut(s) 525
BtsI GCAGTG 2 cut(s) 420, 633
BtsIMutI CAGTG 2 cut(s) 420, 633
BveI ACCTGC 1 cut(s) 859
Cac8I GCNNGC 4 cut(s) 71, 75, 523, 810
CciI TCATGA 1 cut(s) 481
Cfr13I GGNCC 1 cut(s) 503
Csp6I GTAC 6 cut(s) 41, 252, 292, 365, 703, 920
CspCI CAANNNNNGTGG 2 cut(s) 285, 320
CviAII CATG 7 cut(s) 7, 182, 362, 372, 482, 553, 905
CviQI GTAC 6 cut(s) 41, 252, 292, 365, 703, 920
DdeI CTNAG 3 cut(s) 350, 690, 827
DpnI GATC 3 cut(s) 486, 649, 886
DpnII GATC 3 cut(s) 484, 647, 884
EaeI YGGCCR 2 cut(s) 557, 873
Eam1104I CTCTTC 1 cut(s) 434
EarI CTCTTC 1 cut(s) 434
Eco130I CCWWGG 1 cut(s) 152
Eco47I GGWCC 1 cut(s) 503
Eco57I CTGAAG 1 cut(s) 315
EcoT14I CCWWGG 1 cut(s) 152
EcoT22I ATGCAT 1 cut(s) 861
ErhI CCWWGG 1 cut(s) 152
FaeI CATG 7 cut(s) 10, 185, 365, 375, 485, 556, 908
FatI CATG 7 cut(s) 6, 181, 361, 371, 481, 552, 904
FauNDI CATATG 2 cut(s) 278, 861
FblI GTMKAC 1 cut(s) 376
Fnu4HI GCNGC 2 cut(s) 624, 813
FokI GGATG 1 cut(s) 512
Fsp4HI GCNGC 2 cut(s) 624, 813
FspBI CTAG 1 cut(s) 380
GluI GCNGC 2 cut(s) 624, 813
GsaI CCCAGC 1 cut(s) 98
GsuI CTGGAG 2 cut(s) 583, 837
HaeIII GGCC 2 cut(s) 559, 875
Hin1II CATG 7 cut(s) 10, 185, 365, 375, 485, 556, 908
HinfI GANTC 5 cut(s) 320, 358, 409, 442, 478
Hpy166II GTNNAC 2 cut(s) 377, 705
Hpy188I TCNGA 5 cut(s) 334, 489, 747, 787, 800
Hpy188III TCNNGA 7 cut(s) 482, 497, 512, 641, 655, 728, 882
Hpy8I GTNNAC 2 cut(s) 377, 705
HpyAV CCTTC 3 cut(s) 301, 494, 798
HpyCH4III ACNGT 3 cut(s) 238, 256, 592
HpyCH4IV ACGT 1 cut(s) 672
HpyF10VI GCNNNNNNNGC 1 cut(s) 686
HpyF3I CTNAG 3 cut(s) 350, 690, 827
HpySE526I ACGT 1 cut(s) 672
Hsp92II CATG 7 cut(s) 10, 185, 365, 375, 485, 556, 908
Kzo9I GATC 3 cut(s) 484, 647, 884
LmnI GCTCC 1 cut(s) 841
Lsp1109I GCAGC 2 cut(s) 635, 824
LweI GCATC 2 cut(s) 534, 588
MaeI CTAG 1 cut(s) 380
MaeII ACGT 1 cut(s) 672
MaeIII GTNAC 2 cut(s) 281, 664
MalI GATC 3 cut(s) 486, 649, 886
MboI GATC 3 cut(s) 484, 647, 884
MboII GAAGA 4 cut(s) 208, 347, 451, 716
MfeI CAATTG 3 cut(s) 16, 426, 561
MflI RGATCY 1 cut(s) 647
MhlI GDGCHC 1 cut(s) 737
MlsI TGGCCA 2 cut(s) 559, 875
MluCI AATT 4 cut(s) 16, 426, 561, 877
MluNI TGGCCA 2 cut(s) 559, 875
MlyI GAGTC 1 cut(s) 451
MmeI TCCRAC 2 cut(s) 553, 592
MnlI CCTC 9 cut(s) 163, 423, 560, 653, 724, 794, 812, 838, 889
Mox20I TGGCCA 2 cut(s) 559, 875
Mph1103I ATGCAT 1 cut(s) 861
MroXI GAANNNNTTC 1 cut(s) 200
MscI TGGCCA 2 cut(s) 559, 875
MseI TTAA 5 cut(s) 48, 101, 240, 342, 459
MslI CAYNNNNRTG 1 cut(s) 186
Msp20I TGGCCA 2 cut(s) 559, 875
MspA1I CMGCKG 1 cut(s) 815
MunI CAATTG 3 cut(s) 16, 426, 561
MwoI GCNNNNNNNGC 1 cut(s) 686
NdeI CATATG 2 cut(s) 278, 861
NdeII GATC 3 cut(s) 484, 647, 884
NlaIII CATG 7 cut(s) 10, 185, 365, 375, 485, 556, 908
NlaIV GGNNCC 2 cut(s) 736, 849
NmuCI GTSAC 1 cut(s) 664
NsiI ATGCAT 1 cut(s) 861
NspI RCATGY 2 cut(s) 10, 375
PagI TCATGA 1 cut(s) 481
PaqCI CACCTGC 1 cut(s) 859
PciI ACATGT 1 cut(s) 6
PdmI GAANNNNTTC 1 cut(s) 200
PfeI GAWTC 4 cut(s) 320, 358, 409, 478
PkrI GCNGC 2 cut(s) 625, 814
PleI GAGTC 1 cut(s) 450
PpsI GAGTC 1 cut(s) 450
Ppu21I YACGTR 1 cut(s) 673
PscI ACATGT 1 cut(s) 6
PshAI GACNNNNGTC 1 cut(s) 593
PspFI CCCAGC 1 cut(s) 94
PspN4I GGNNCC 2 cut(s) 736, 849
PspPI GGNCC 1 cut(s) 503
PsuI RGATCY 1 cut(s) 647
PvuII CAGCTG 1 cut(s) 815
RsaI GTAC 6 cut(s) 42, 253, 293, 366, 704, 921
RsaNI GTAC 6 cut(s) 41, 252, 292, 365, 703, 920
RseI CAYNNNNRTG 1 cut(s) 186
SaqAI TTAA 5 cut(s) 48, 101, 240, 342, 459
SatI GCNGC 2 cut(s) 624, 813
Sau3AI GATC 3 cut(s) 484, 647, 884
Sau96I GGNCC 1 cut(s) 503
SchI GAGTC 1 cut(s) 451
SduI GDGCHC 1 cut(s) 737
SfaNI GCATC 2 cut(s) 534, 588
SfcI CTRYAG 1 cut(s) 255
SinI GGWCC 1 cut(s) 503
SmiMI CAYNNNNRTG 1 cut(s) 186
SpeI ACTAGT 1 cut(s) 379
Sse9I AATT 4 cut(s) 16, 426, 561, 877
SspI AATATT 1 cut(s) 60
SspMI CTAG 1 cut(s) 380
StyI CCWWGG 1 cut(s) 152
TaaI ACNGT 3 cut(s) 238, 256, 592
TaiI ACGT 1 cut(s) 675
TaqI TCGA 4 cut(s) 472, 496, 727, 760
TasI AATT 4 cut(s) 16, 426, 561, 877
TatI WGTACW 2 cut(s) 251, 702
TfiI GAWTC 4 cut(s) 320, 358, 409, 478
Tru1I TTAA 5 cut(s) 48, 101, 240, 342, 459
Tru9I TTAA 5 cut(s) 48, 101, 240, 342, 459
TscAI CASTG 2 cut(s) 427, 633
TseFI GTSAC 1 cut(s) 664
TseI GCWGC 2 cut(s) 623, 812
Tsp45I GTSAC 1 cut(s) 664
TspDTI ATGAA 3 cut(s) 350, 470, 921
TspGWI ACGGA 1 cut(s) 784
TspRI CASTG 2 cut(s) 427, 633
VpaK11BI GGWCC 1 cut(s) 503
XceI RCATGY 2 cut(s) 10, 375
XmiI GTMKAC 1 cut(s) 376
XmnI GAANNNNTTC 1 cut(s) 200
XspI CTAG 1 cut(s) 380
Zsp2I ATGCAT 1 cut(s) 861
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.