Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_co8427491.1

Orthogroup ID

OG0010893

Physical Location & Seq

Genomic Coordinates Reverse (-)

793 .. 1206

Gene Structure 414 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_co8427491.1_g000001.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 414 bp

atgtccacagtgggctttcagtacatgctaatctggtttttggaacaggttattatggcagcaagaaccagaggtggggatgaggctgttgttcagtccttgcaacgtgctcgtgagctatacagatgtagattgcaagaaagcactgctgttgatcagttagcctctttgtttgccgagtgcgcaattgatgaagctcagccttcaaaacctgaatcatcagcacataacgtgagtggcccgtcagctggacctgatgctcatggaacttctatactggcggaaagtggcaggatgcagattgtgctggatgcattttcagatgggagcagcttcatttgcttacagtgtggaggtcttgttagcaatcatcgcaaagacgagcactatgcctactggtgttgccaaatttga

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

No domains found.

Protein Analysis

137

Amino Acids

15.02

Weight (kDa)

5.06

Isoelectric Point (pI)

45.43

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0010893)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT5G47830 AT5G47830
fragaria_vesca	FvH4_2g33950
malus_domestica	MD06G1210300.v1.1 MD08G1095400.v1.1 MD15G1077900.v1.1 MD17G1062600.v1.1
prunus_persica	Prupe.1G431400_v2.0.a1
pyrus_communis	pycom15g07260
rosa_chinensis	RchiOBHm_Chr6g0308461
rosa_laevigata	RLG00000010641
rosa_multiflora	Rmu_co8427491.1_g000001 Rmu_sc0011796.1_g000007
rosa_roxburghii	Rroxscaffold_7G00160110
rosa_rugosa	Rorug06G0367000
rosa_samantha	Rh6AG476700 Rh6BG486900 Rh6CG492000 Rh6DG478100
rosa_wichuraiana	Rw6G041580

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
Acc16I	TGCGCA	1 cut(s)	184
AciI	CCGC	1 cut(s)	281
AcsI	RAATTY	1 cut(s)	408
AfaI	GTAC	1 cut(s)	23
AfiI	CCNNNNNNNGG	2 cut(s)	75, 248
AgsI	TTSAA	1 cut(s)	207
AluBI	AGCT	4 cut(s)	118, 197, 248, 333
AluI	AGCT	4 cut(s)	118, 197, 248, 333
Alw21I	GWGCWC	2 cut(s)	112, 387
AoxI	GGCC	1 cut(s)	238
ApeKI	GCWGC	2 cut(s)	59, 330
ApoI	RAATTY	1 cut(s)	408
AspLEI	GCGC	1 cut(s)	185
AspS9I	GGNCC	2 cut(s)	239, 251
AvaII	GGWCC	1 cut(s)	251
BauI	CACGAG	1 cut(s)	111
Bbv12I	GWGCWC	2 cut(s)	112, 387
BbvI	GCAGC	2 cut(s)	71, 342
BccI	CCATC	1 cut(s)	317
BcgI	CGANNNNNNTGC	4 cut(s)	92, 126, 371, 405
BclI	TGATCA	1 cut(s)	154
BisI	GCNGC	2 cut(s)	60, 331
BlpI	GCTNAGC	1 cut(s)	198
BlsI	GCNGC	2 cut(s)	61, 332
Bme18I	GGWCC	1 cut(s)	251
BmgT120I	GGNCC	2 cut(s)	239, 251
BmsI	GCATC	3 cut(s)	247, 285, 301
Bpu1102I	GCTNAGC	1 cut(s)	198
BsaXI	ACNNNNNCTCC	2 cut(s)	345, 375
Bsc4I	CCNNNNNNNGG	2 cut(s)	75, 248
Bse1I	ACTGG	2 cut(s)	282, 401
BseGI	GGATG	3 cut(s)	85, 300, 316
BseLI	CCNNNNNNNGG	2 cut(s)	75, 248
BseMII	CTCAG	1 cut(s)	212
BseNI	ACTGG	2 cut(s)	282, 401
BseXI	GCAGC	2 cut(s)	71, 342
BshFI	GGCC	1 cut(s)	240
BsiHKAI	GWGCWC	2 cut(s)	112, 387
BslI	CCNNNNNNNGG	2 cut(s)	75, 248
BsnI	GGCC	1 cut(s)	240
Bsp1286I	GDGCHC	2 cut(s)	112, 387
Bsp143I	GATC	1 cut(s)	154
Bsp1720I	GCTNAGC	1 cut(s)	198
BspACI	CCGC	1 cut(s)	281
BspANI	GGCC	1 cut(s)	240
BspCNI	CTCAG	1 cut(s)	211
BsrI	ACTGG	2 cut(s)	282, 401
BssMI	GATC	1 cut(s)	154
BssSI	CACGAG	1 cut(s)	111
Bst2BI	CACGAG	1 cut(s)	111
Bst4CI	ACNGT	2 cut(s)	10, 348
BstAPI	GCANNNNNTGC	1 cut(s)	304
BstDEI	CTNAG	1 cut(s)	198
BstF5I	GGATG	3 cut(s)	85, 300, 316
BstHHI	GCGC	1 cut(s)	185
BstKTI	GATC	1 cut(s)	157
BstMBI	GATC	1 cut(s)	154
BstMWI	GCNNNNNNNGC	4 cut(s)	182, 304, 339, 372
BstNSI	RCATGY	1 cut(s)	28
BstV1I	GCAGC	2 cut(s)	71, 342
BsuRI	GGCC	1 cut(s)	240
BtgZI	GCGATG	1 cut(s)	356
BtsCI	GGATG	3 cut(s)	85, 300, 316
BtsI	GCAGTG	1 cut(s)	144
BtsIMutI	CAGTG	3 cut(s)	15, 144, 353
CfoI	GCGC	1 cut(s)	185
Cfr13I	GGNCC	2 cut(s)	239, 251
Csp6I	GTAC	1 cut(s)	22
CviAII	CATG	2 cut(s)	25, 263
CviJI	RGCY	9 cut(s)	15, 86, 118, 164, 197, 202, 240, 248, 333
CviKI_1	RGCY	9 cut(s)	15, 86, 118, 164, 197, 202, 240, 248, 333
CviQI	GTAC	1 cut(s)	22
DdeI	CTNAG	1 cut(s)	198
DpnI	GATC	1 cut(s)	156
DpnII	GATC	1 cut(s)	154
EciI	GGCGGA	1 cut(s)	296
Eco47I	GGWCC	1 cut(s)	251
EcoT22I	ATGCAT	1 cut(s)	316
FaeI	CATG	2 cut(s)	28, 266
FaiI	YATR	7 cut(s)	26, 56, 121, 228, 264, 275, 390
FatI	CATG	2 cut(s)	24, 262
FbaI	TGATCA	1 cut(s)	154
Fnu4HI	GCNGC	2 cut(s)	60, 331
FokI	GGATG	3 cut(s)	92, 307, 323
Fsp4HI	GCNGC	2 cut(s)	60, 331
FspI	TGCGCA	1 cut(s)	184
GlaI	GCGC	1 cut(s)	184
GluI	GCNGC	2 cut(s)	60, 331
HaeIII	GGCC	1 cut(s)	240
HhaI	GCGC	1 cut(s)	185
Hin1II	CATG	2 cut(s)	28, 266
Hin6I	GCGC	1 cut(s)	183
HinP1I	GCGC	1 cut(s)	183
HinfI	GANTC	1 cut(s)	215
Hpy166II	GTNNAC	1 cut(s)	6
Hpy188I	TCNGA	1 cut(s)	322
Hpy188III	TCNNGA	1 cut(s)	113
Hpy8I	GTNNAC	1 cut(s)	6
HpyAV	CCTTC	1 cut(s)	213
HpyCH4III	ACNGT	2 cut(s)	10, 348
HpyCH4IV	ACGT	2 cut(s)	106, 231
HpyCH4V	TGCA	4 cut(s)	103, 136, 298, 314
HpyF10VI	GCNNNNNNNGC	4 cut(s)	182, 304, 339, 372
HpyF3I	CTNAG	1 cut(s)	198
HpySE526I	ACGT	2 cut(s)	106, 231
Hsp92II	CATG	2 cut(s)	28, 266
HspAI	GCGC	1 cut(s)	183
Ksp22I	TGATCA	1 cut(s)	154
Kzo9I	GATC	1 cut(s)	154
LmnI	GCTCC	1 cut(s)	327
Lsp1109I	GCAGC	2 cut(s)	71, 342
LweI	GCATC	3 cut(s)	247, 285, 301
MaeII	ACGT	2 cut(s)	106, 231
MalI	GATC	1 cut(s)	156
MboI	GATC	1 cut(s)	154
MfeI	CAATTG	1 cut(s)	186
MhlI	GDGCHC	2 cut(s)	112, 387
MluCI	AATT	2 cut(s)	186, 408
MnlI	CCTC	4 cut(s)	65, 76, 175, 347
Mph1103I	ATGCAT	1 cut(s)	316
MspA1I	CMGCKG	1 cut(s)	248
MunI	CAATTG	1 cut(s)	186
MwoI	GCNNNNNNNGC	4 cut(s)	182, 304, 339, 372
NdeII	GATC	1 cut(s)	154
NlaIII	CATG	2 cut(s)	28, 266
NmeAIII	GCCGAG	1 cut(s)	202
NsbI	TGCGCA	1 cut(s)	184
NsiI	ATGCAT	1 cut(s)	316
NspI	RCATGY	1 cut(s)	28
PfeI	GAWTC	1 cut(s)	215
PkrI	GCNGC	2 cut(s)	61, 332
PspPI	GGNCC	2 cut(s)	239, 251
PvuII	CAGCTG	1 cut(s)	248
RsaI	GTAC	1 cut(s)	23
RsaNI	GTAC	1 cut(s)	22
SatI	GCNGC	2 cut(s)	60, 331
Sau3AI	GATC	1 cut(s)	154
Sau96I	GGNCC	2 cut(s)	239, 251
SduI	GDGCHC	2 cut(s)	112, 387
SfaNI	GCATC	3 cut(s)	247, 285, 301
SinI	GGWCC	1 cut(s)	251
Sse9I	AATT	2 cut(s)	186, 408
SsiI	CCGC	1 cut(s)	281
TaaI	ACNGT	2 cut(s)	10, 348
TaiI	ACGT	2 cut(s)	109, 234
TasI	AATT	2 cut(s)	186, 408
TatI	WGTACW	1 cut(s)	21
TfiI	GAWTC	1 cut(s)	215
TscAI	CASTG	3 cut(s)	15, 151, 353
TseI	GCWGC	2 cut(s)	59, 330
TspDTI	ATGAA	2 cut(s)	207, 325
TspRI	CASTG	3 cut(s)	15, 151, 353
VpaK11BI	GGWCC	1 cut(s)	251
XapI	RAATTY	1 cut(s)	408
XceI	RCATGY	1 cut(s)	28
Zsp2I	ATGCAT	1 cut(s)	316

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.