Rmu_co8433651.1_g000001
ERF Family

mTERF

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co8433651.1
Physical Location & Seq
Reverse (-)
1026 .. 1519
494 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co8433651.1_g000001.1.cds

Sequence Viewer

Length: 494 bp
cagaacataacttcagaaaggtcatcaacaaatgcccaagattgcttgcttcaagtgtgagtgaccagctcaaaccagctttgttttatcttcagagacttgggttcaaggatttgcatgctttagcttaccatgactctgtgctcttggtttcgagtgtggaaaagaccctgattcccaagttaaattttttggtcggtttggggattccaagagatgaggctgtggggttggtgctgaggtgtcctgcattgctcactttcagcattgagaataactacaagccaaagtatgagtacttctctgtggatatgggattgaaattggaggatttgaaggagtttcctcagtactttgcttttagtttggagaagaggataaagccaaggcatatggaggttgtgcaaagtggggtacatgtgcctttgccacttatgctcaagagcactgatgaggagtttagggagttgctgaagcaatttgggggtggatga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

163

Amino Acids

18.66

Weight (kDa)

8.83

Isoelectric Point (pI)

32.34

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0011360)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 186
AcuI CTGAAG 2 cut(s) 76, 493
AfaI GTAC 3 cut(s) 298, 352, 416
AflIII ACRYGT 1 cut(s) 417
AgsI TTSAA 4 cut(s) 53, 108, 321, 336
AluBI AGCT 3 cut(s) 69, 79, 127
AluI AGCT 3 cut(s) 69, 79, 127
Alw21I GWGCWC 2 cut(s) 146, 448
Alw26I GTCTC 1 cut(s) 90
ApoI RAATTY 1 cut(s) 186
BarI GAAGNNNNNNTAC 2 cut(s) 283, 315
Bbv12I GWGCWC 2 cut(s) 146, 448
BbvCI CCTCAGC 1 cut(s) 238
BcoDI GTCTC 1 cut(s) 90
BmcAI AGTACT 2 cut(s) 298, 352
BplI GAGNNNNNCTC 2 cut(s) 286, 318
Bpu10I CCTNAGC 1 cut(s) 238
BpuEI CTTGAG 1 cut(s) 424
BsaJI CCNNGG 1 cut(s) 385
Bse3DI GCAATG 1 cut(s) 250
BseDI CCNNGG 1 cut(s) 385
BseMI GCAATG 1 cut(s) 250
BseMII CTCAG 2 cut(s) 229, 361
BseRI GAGGAG 1 cut(s) 469
BsiHKAI GWGCWC 2 cut(s) 146, 448
BsmAI GTCTC 1 cut(s) 90
Bsp1286I GDGCHC 2 cut(s) 146, 448
BspCNI CTCAG 2 cut(s) 230, 360
BsrDI GCAATG 1 cut(s) 250
BssECI CCNNGG 1 cut(s) 385
BssT1I CCWWGG 1 cut(s) 385
Bst6I CTCTTC 1 cut(s) 367
BstC8I GCNNGC 2 cut(s) 47, 119
BstDEI CTNAG 2 cut(s) 238, 347
BstMAI GTCTC 1 cut(s) 90
BstMWI GCNNNNNNNGC 1 cut(s) 435
BstNSI RCATGY 2 cut(s) 121, 421
BtsIMutI CAGTG 1 cut(s) 446
Cac8I GCNNGC 2 cut(s) 47, 119
Csp6I GTAC 3 cut(s) 297, 351, 415
CviAII CATG 3 cut(s) 118, 133, 418
CviJI RGCY 6 cut(s) 69, 79, 127, 223, 285, 384
CviKI_1 RGCY 6 cut(s) 69, 79, 127, 223, 285, 384
CviQI GTAC 3 cut(s) 297, 351, 415
DdeI CTNAG 2 cut(s) 238, 347
Eam1104I CTCTTC 1 cut(s) 367
EarI CTCTTC 1 cut(s) 367
Eco130I CCWWGG 1 cut(s) 385
Eco57I CTGAAG 2 cut(s) 76, 493
EcoT14I CCWWGG 1 cut(s) 385
ErhI CCWWGG 1 cut(s) 385
FaeI CATG 3 cut(s) 121, 136, 421
FaiI YATR 9 cut(s) 8, 119, 134, 293, 313, 392, 394, 419, 436
FatI CATG 3 cut(s) 117, 132, 417
FauNDI CATATG 1 cut(s) 392
Hin1II CATG 3 cut(s) 121, 136, 421
HinfI GANTC 3 cut(s) 136, 174, 207
Hpy188I TCNGA 2 cut(s) 16, 95
Hpy188III TCNNGA 1 cut(s) 441
HpyAV CCTTC 1 cut(s) 330
HpyCH4V TGCA 3 cut(s) 117, 250, 405
HpyF10VI GCNNNNNNNGC 1 cut(s) 435
HpyF3I CTNAG 2 cut(s) 238, 347
Hsp92II CATG 3 cut(s) 121, 136, 421
LpnPI CCDG 4 cut(s) 79, 89, 184, 260
MaeIII GTNAC 1 cut(s) 61
MboII GAAGA 2 cut(s) 82, 384
MhlI GDGCHC 2 cut(s) 146, 448
MluCI AATT 3 cut(s) 186, 322, 478
MlyI GAGTC 1 cut(s) 130
MnlI CCTC 7 cut(s) 213, 233, 321, 356, 368, 390, 447
MseI TTAA 1 cut(s) 184
MwoI GCNNNNNNNGC 1 cut(s) 435
NdeI CATATG 1 cut(s) 392
NlaIII CATG 3 cut(s) 121, 136, 421
NmuCI GTSAC 1 cut(s) 61
NspI RCATGY 2 cut(s) 121, 421
PaeI GCATGC 1 cut(s) 121
PciI ACATGT 1 cut(s) 417
PfeI GAWTC 2 cut(s) 174, 207
PleI GAGTC 1 cut(s) 130
PpsI GAGTC 1 cut(s) 130
PscI ACATGT 1 cut(s) 417
RsaI GTAC 3 cut(s) 298, 352, 416
RsaNI GTAC 3 cut(s) 297, 351, 415
SaqAI TTAA 1 cut(s) 184
ScaI AGTACT 2 cut(s) 298, 352
SchI GAGTC 1 cut(s) 130
SduI GDGCHC 2 cut(s) 146, 448
SetI ASST 6 cut(s) 23, 71, 81, 129, 244, 401
SmlI CTYRAG 1 cut(s) 439
SmoI CTYRAG 1 cut(s) 439
SphI GCATGC 1 cut(s) 121
Sse9I AATT 3 cut(s) 186, 322, 478
StyI CCWWGG 1 cut(s) 385
TaqI TCGA 1 cut(s) 154
TasI AATT 3 cut(s) 186, 322, 478
TatI WGTACW 2 cut(s) 296, 350
TfiI GAWTC 2 cut(s) 174, 207
Tru1I TTAA 1 cut(s) 184
Tru9I TTAA 1 cut(s) 184
TscAI CASTG 1 cut(s) 453
TseFI GTSAC 1 cut(s) 61
Tsp45I GTSAC 1 cut(s) 61
TspRI CASTG 1 cut(s) 453
XapI RAATTY 1 cut(s) 186
XceI RCATGY 2 cut(s) 121, 421
ZrmI AGTACT 2 cut(s) 298, 352
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.