Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_co8448951.1

Orthogroup ID

OG0005911

Physical Location & Seq

Genomic Coordinates Reverse (-)

1 .. 1574

Gene Structure 1574 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_co8448951.1_g000001.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 922 bp

atggcttttacctcacagaacaacagcttctgcttcttggtgcttttgttcctgtttagcatagcttcagcacaattgtcctcagattactatgcaacaagatgcccgaaagccctttctacagttcggactgcagttattaatgctgtggtgaaggagcatcgcatgggggcatccttgctccgtctccattttcacgattgctttgttaatggatgtgatgcatctgttctattagatgacactgcaaattttactggggagaaaacagcgttaccaaatttggactctataagaggatttgaagtgattgatactataaaatctcaactggaaagcatctgccctggggttgtttcctgtgcagacatccttgccattgcagcccgtgattcagttgtttcgttgggagggccttcgtggatagttcagttaggcagaagagattccacaacagcaagtttaagtgctgcaaatactgatctcccatctccaagcctagatgttaatgacctcatctctgccttctcgaataaaggctttagtgccaaagatttggtagctctctcaggatctcacacaatgggtcaagccaggtgtgtattgttccgagaccggatctataatgagactgacatcaactcagcacttgctacatcactgaaatcaaactgtccaagctcagggagtgatgacaacctttccccactggatgttacaagtcctgttttcttcgacaacgcttattataagaacttggttaatagcaagggtctcttgcattctgaccaacaactcttcagtggtggttcaacagattctcaggttacgacttacagcaccaaccctttagctttctttgcagattttgccaatgccatggtgaaaatggggaacctcaacctgcttactggatccaatg

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

ko00940 ko01100 ko01110 map00940 map01100 map01110

Pfam Domains

Protein Families

peroxidase

Protein Analysis

307

Amino Acids

32.82

Weight (kDa)

5.13

Isoelectric Point (pI)

28.23

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0005911)

Species	Orthologous Gene IDs
fragaria_vesca	FvH4_3g40081 FvH4_6g10250 FvH4_6g10250 FvH4_6g10250
malus_domestica	MD03G1058900.v1.1 MD04G1170900.v1.1 MD12G1184600.v1.1
prunus_persica	Prupe.6G044900_v2.0.a1 Prupe.6G289400_v2.0.a1 Prupe.6G289400_v2.0.a1
pyrus_communis	pycom04g15160 pycom12g17350
rosa_chinensis	RchiOBHm_Chr3g0461001 RchiOBHm_Chr5g0072281
rosa_laevigata	RLG00000024959 RLG00000036291
rosa_multiflora	Rmu_co8448951.1_g000001 Rmu_sc0006670.1_g000023 Rmu_sc0007017.1_g000015
rosa_roxburghii	Rroxscaffold_6G00418950
rosa_rugosa	Rorug03G0047700
rosa_samantha	Rh3AG105100 Rh3CG110400 Rh3DG110700 Rh5BG493600 Rh5CG517600
rosa_wichuraiana	Rw3G008990 Rw5G043980

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AanI	TTATAA	1 cut(s)	750
Acc36I	ACCTGC	1 cut(s)	912
AclWI	GGATC	3 cut(s)	580, 626, 909
AcsI	RAATTY	2 cut(s)	250, 280
AcuI	CTGAAG	2 cut(s)	51, 784
AfiI	CCNNNNNNNGG	1 cut(s)	683
AgsI	TTSAA	2 cut(s)	305, 813
AjnI	CCWGG	2 cut(s)	346, 593
AluBI	AGCT	5 cut(s)	27, 65, 563, 681, 854
AluI	AGCT	5 cut(s)	27, 65, 563, 681, 854
Alw26I	GTCTC	4 cut(s)	191, 606, 623, 779
AlwI	GGATC	3 cut(s)	580, 626, 909
AlwNI	CAGNNNCTG	1 cut(s)	30
AoxI	GGCC	1 cut(s)	413
ApeKI	GCWGC	2 cut(s)	383, 470
ApoI	RAATTY	2 cut(s)	250, 280
AseI	ATTAAT	1 cut(s)	141
Asp700I	GAANNNNTTC	1 cut(s)	445
AspS9I	GGNCC	1 cut(s)	413
AsuHPI	GGTGA	2 cut(s)	163, 895
BamHI	GGATCC	1 cut(s)	914
BbvI	GCAGC	2 cut(s)	395, 457
BccI	CCATC	1 cut(s)	496
BciT130I	CCWGG	2 cut(s)	348, 595
BcoDI	GTCTC	4 cut(s)	191, 606, 623, 779
BfaI	CTAG	1 cut(s)	500
BfmI	CTRYAG	2 cut(s)	120, 132
BfuAI	ACCTGC	1 cut(s)	912
BisI	GCNGC	2 cut(s)	384, 471
BlsI	GCNGC	2 cut(s)	385, 472
Bme1390I	CCNGG	2 cut(s)	348, 595
BmgT120I	GGNCC	1 cut(s)	413
BmiI	GGNNCC	2 cut(s)	896, 916
BmrFI	CCNGG	2 cut(s)	348, 595
BmrI	ACTGGG	1 cut(s)	267
BmsI	GCATC	6 cut(s)	92, 169, 182, 211, 233, 348
BmuI	ACTGGG	1 cut(s)	267
Bpu10I	CCTNAGC	1 cut(s)	682
BsaI	GGTCTC	2 cut(s)	606, 779
BsaJI	CCNNGG	3 cut(s)	346, 347, 879
BsaWI	WCCGGW	1 cut(s)	615
Bsc4I	CCNNNNNNNGG	1 cut(s)	683
Bse1I	ACTGG	4 cut(s)	262, 336, 714, 916
Bse3DI	GCAATG	1 cut(s)	378
BseBI	CCWGG	2 cut(s)	348, 595
BseDI	CCNNGG	3 cut(s)	346, 347, 879
BseGI	GGATG	4 cut(s)	173, 221, 369, 718
BseLI	CCNNNNNNNGG	1 cut(s)	683
BseMI	GCAATG	1 cut(s)	378
BseMII	CTCAG	5 cut(s)	96, 582, 657, 696, 836
BseNI	ACTGG	4 cut(s)	262, 336, 714, 916
BseXI	GCAGC	2 cut(s)	395, 457
BsgI	GTGCAG	1 cut(s)	384
BshFI	GGCC	1 cut(s)	415
BsiSI	CCGG	1 cut(s)	616
BslI	CCNNNNNNNGG	1 cut(s)	683
BsmAI	GTCTC	4 cut(s)	191, 606, 623, 779
BsmBI	CGTCTC	1 cut(s)	191
BsmI	GAATGC	1 cut(s)	781
BsnI	GGCC	1 cut(s)	415
Bso31I	GGTCTC	2 cut(s)	606, 779
Bsp143I	GATC	4 cut(s)	481, 572, 618, 914
Bsp19I	CCATGG	1 cut(s)	879
BspANI	GGCC	1 cut(s)	415
BspCNI	CTCAG	5 cut(s)	95, 581, 656, 695, 835
BspLI	GGNNCC	2 cut(s)	896, 916
BspMAI	CTGCAG	1 cut(s)	136
BspMI	ACCTGC	1 cut(s)	912
BspPI	GGATC	3 cut(s)	580, 626, 909
BspTNI	GGTCTC	2 cut(s)	606, 779
BsrDI	GCAATG	1 cut(s)	378
BsrI	ACTGG	4 cut(s)	262, 336, 714, 916
BssECI	CCNNGG	3 cut(s)	346, 347, 879
BssMI	GATC	4 cut(s)	481, 572, 618, 914
BssT1I	CCWWGG	1 cut(s)	879
Bst2UI	CCWGG	2 cut(s)	348, 595
Bst4CI	ACNGT	2 cut(s)	124, 674
Bst6I	CTCTTC	2 cut(s)	436, 803
BstAPI	GCANNNNNTGC	1 cut(s)	869
BstDEI	CTNAG	5 cut(s)	82, 568, 643, 682, 822
BstDSI	CCRYGG	1 cut(s)	879
BstF5I	GGATG	4 cut(s)	173, 221, 369, 718
BstKTI	GATC	4 cut(s)	484, 575, 621, 917
BstMAI	GTCTC	4 cut(s)	191, 606, 623, 779
BstMBI	GATC	4 cut(s)	481, 572, 618, 914
BstMWI	GCNNNNNNNGC	3 cut(s)	383, 860, 869
BstNI	CCWGG	2 cut(s)	348, 595
BstSCI	CCNGG	2 cut(s)	346, 593
BstSFI	CTRYAG	2 cut(s)	120, 132
BstV1I	GCAGC	2 cut(s)	395, 457
BstX2I	RGATCY	3 cut(s)	572, 618, 914
BstXI	CCANNNNNNTGG	2 cut(s)	556, 880
BstYI	RGATCY	3 cut(s)	572, 618, 914
BsuRI	GGCC	1 cut(s)	415
BtgI	CCRYGG	1 cut(s)	879
BtgZI	GCGATG	1 cut(s)	146
BtsCI	GGATG	4 cut(s)	173, 221, 369, 718
BtsI	GCAGTG	1 cut(s)	243
BtsIMutI	CAGTG	4 cut(s)	243, 659, 707, 808
BveI	ACCTGC	1 cut(s)	912
CaiI	CAGNNNCTG	1 cut(s)	30
Cfr13I	GGNCC	1 cut(s)	413
CviAII	CATG	2 cut(s)	166, 880
DdeI	CTNAG	5 cut(s)	82, 568, 643, 682, 822
DpnI	GATC	4 cut(s)	483, 574, 620, 916
DpnII	GATC	4 cut(s)	481, 572, 618, 914
Eam1104I	CTCTTC	2 cut(s)	436, 803
EarI	CTCTTC	2 cut(s)	436, 803
Eco130I	CCWWGG	1 cut(s)	879
Eco31I	GGTCTC	2 cut(s)	606, 779
Eco57I	CTGAAG	2 cut(s)	51, 784
EcoO109I	RGGNCCY	1 cut(s)	413
EcoRII	CCWGG	2 cut(s)	346, 593
EcoT14I	CCWWGG	1 cut(s)	879
EcoT22I	ATGCAT	1 cut(s)	226
ErhI	CCWWGG	1 cut(s)	879
Esp3I	CGTCTC	1 cut(s)	191
FaeI	CATG	2 cut(s)	169, 883
FaiI	YATR	8 cut(s)	62, 93, 167, 293, 320, 624, 750, 881
FalI	AAGNNNNNCTT	2 cut(s)	761, 793
FatI	CATG	2 cut(s)	165, 879
Fnu4HI	GCNGC	2 cut(s)	384, 471
FokI	GGATG	4 cut(s)	160, 228, 356, 725
Fsp4HI	GCNGC	2 cut(s)	384, 471
FspBI	CTAG	1 cut(s)	500
GluI	GCNGC	2 cut(s)	384, 471
HaeIII	GGCC	1 cut(s)	415
HapII	CCGG	1 cut(s)	616
Hin1II	CATG	2 cut(s)	169, 883
HinfI	GANTC	4 cut(s)	287, 392, 446, 818
HpaII	CCGG	1 cut(s)	616
HphI	GGTGA	2 cut(s)	163, 895
Hpy188I	TCNGA	4 cut(s)	85, 129, 611, 787
Hpy188III	TCNNGA	3 cut(s)	197, 529, 570
HpyAV	CCTTC	3 cut(s)	148, 426, 535
HpyCH4III	ACNGT	2 cut(s)	124, 674
HpyCH4V	TGCA	9 cut(s)	95, 134, 224, 248, 365, 383, 473, 781, 863
HpyF10VI	GCNNNNNNNGC	3 cut(s)	383, 860, 869
HpyF3I	CTNAG	5 cut(s)	82, 568, 643, 682, 822
Hsp92II	CATG	2 cut(s)	169, 883
Kzo9I	GATC	4 cut(s)	481, 572, 618, 914
LmnI	GCTCC	2 cut(s)	157, 186
Lsp1109I	GCAGC	2 cut(s)	395, 457
LweI	GCATC	6 cut(s)	92, 169, 182, 211, 233, 348
MaeI	CTAG	1 cut(s)	500
MaeIII	GTNAC	3 cut(s)	273, 715, 826
MalI	GATC	4 cut(s)	483, 574, 620, 916
MboI	GATC	4 cut(s)	481, 572, 618, 914
MboII	GAAGA	3 cut(s)	453, 724, 790
MfeI	CAATTG	1 cut(s)	74
MflI	RGATCY	3 cut(s)	572, 618, 914
MluCI	AATT	3 cut(s)	74, 250, 280
MlyI	GAGTC	1 cut(s)	281
MnlI	CCTC	6 cut(s)	22, 91, 290, 404, 524, 908
Mph1103I	ATGCAT	1 cut(s)	226
MroXI	GAANNNNTTC	1 cut(s)	445
MseI	TTAA	5 cut(s)	141, 210, 464, 507, 762
MspI	CCGG	1 cut(s)	616
MspR9I	CCNGG	2 cut(s)	348, 595
MunI	CAATTG	1 cut(s)	74
Mva1269I	GAATGC	1 cut(s)	781
MvaI	CCWGG	2 cut(s)	348, 595
MwoI	GCNNNNNNNGC	3 cut(s)	383, 860, 869
NcoI	CCATGG	1 cut(s)	879
NdeII	GATC	4 cut(s)	481, 572, 618, 914
NlaIII	CATG	2 cut(s)	169, 883
NlaIV	GGNNCC	2 cut(s)	896, 916
NsiI	ATGCAT	1 cut(s)	226
PasI	CCCWGGG	1 cut(s)	347
PctI	GAATGC	1 cut(s)	781
PdmI	GAANNNNTTC	1 cut(s)	445
PfeI	GAWTC	3 cut(s)	392, 446, 818
PkrI	GCNGC	2 cut(s)	385, 472
PleI	GAGTC	1 cut(s)	281
PpsI	GAGTC	1 cut(s)	281
PshBI	ATTAAT	1 cut(s)	141
PsiI	TTATAA	1 cut(s)	750
Psp6I	CCWGG	2 cut(s)	346, 593
PspGI	CCWGG	2 cut(s)	346, 593
PspN4I	GGNNCC	2 cut(s)	896, 916
PspPI	GGNCC	1 cut(s)	413
PstI	CTGCAG	1 cut(s)	136
PstNI	CAGNNNCTG	1 cut(s)	30
PsuI	RGATCY	3 cut(s)	572, 618, 914
SaqAI	TTAA	5 cut(s)	141, 210, 464, 507, 762
SatI	GCNGC	2 cut(s)	384, 471
Sau3AI	GATC	4 cut(s)	481, 572, 618, 914
Sau96I	GGNCC	1 cut(s)	413
SchI	GAGTC	1 cut(s)	281
ScrFI	CCNGG	2 cut(s)	348, 595
SfaNI	GCATC	6 cut(s)	92, 169, 182, 211, 233, 348
SfcI	CTRYAG	2 cut(s)	120, 132
Sse9I	AATT	3 cut(s)	74, 250, 280
SspMI	CTAG	1 cut(s)	500
StyD4I	CCNGG	2 cut(s)	346, 593
StyI	CCWWGG	1 cut(s)	879
TaaI	ACNGT	2 cut(s)	124, 674
TaqI	TCGA	2 cut(s)	530, 735
TasI	AATT	3 cut(s)	74, 250, 280
TfiI	GAWTC	3 cut(s)	392, 446, 818
Tru1I	TTAA	5 cut(s)	141, 210, 464, 507, 762
Tru9I	TTAA	5 cut(s)	141, 210, 464, 507, 762
TscAI	CASTG	4 cut(s)	250, 666, 714, 808
TseI	GCWGC	2 cut(s)	383, 470
TspGWI	ACGGA	1 cut(s)	173
TspRI	CASTG	4 cut(s)	250, 666, 714, 808
VspI	ATTAAT	1 cut(s)	141
XapI	RAATTY	2 cut(s)	250, 280
XcmI	CCANNNNNNNNNTGG	1 cut(s)	886
XmnI	GAANNNNTTC	1 cut(s)	445
XspI	CTAG	1 cut(s)	500
Zsp2I	ATGCAT	1 cut(s)	226

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.