Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_co8462993.1

Orthogroup ID

OG0011310

Physical Location & Seq

Genomic Coordinates Reverse (-)

1 .. 700

Gene Structure 700 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_co8462993.1_g000001.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 273 bp

atgaagtgccagagattcctatcgatcccaatcatcgctgtgcttctgttgatgggtttcatctgttacatcacggtctttattttcatcgacgattgggttgggttgcagagctctgctggttatctgaacgttctgatcttcactgtcttggcctctctttgcctcttctctttctcttcttgtgttctcatcgacccaggtcacaccccagcttcatatatccctgatgttgaagatagtggagtctctgatcaggagcccaagaaaaat

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

DHHC

Protein Analysis

91

Amino Acids

10.04

Weight (kDa)

4.4

Isoelectric Point (pI)

32.07

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0011310)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT5G04270
fragaria_vesca	FvH4_7g18860
malus_domestica	MD01G1104200.v1.1 MD07G1171000.v1.1
prunus_persica	Prupe.2G209800_v2.0.a1 Prupe.2G209800_v2.0.a1 Prupe.2G209800_v2.0.a1
pyrus_communis	pycom01g13090 pycom07g16470
rosa_chinensis	RchiOBHm_Chr1g0362791
rosa_laevigata	RLG00000027621
rosa_multiflora	Rmu_co8462993.1_g000001 Rmu_sc0000046.1_g000004
rosa_roxburghii	Rroxscaffold_4G00293760
rosa_rugosa	Rorug01G0301300
rosa_samantha	Rh1AG310100 Rh1BG273500 Rh1CG290600 Rh1DG304200
rosa_wichuraiana	Rw1G027510

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AclI	AACGTT	1 cut(s)	132
AclWI	GGATC	1 cut(s)	19
AgsI	TTSAA	1 cut(s)	236
AjnI	CCWGG	1 cut(s)	199
AluBI	AGCT	2 cut(s)	114, 215
AluI	AGCT	2 cut(s)	114, 215
Alw21I	GWGCWC	1 cut(s)	116
Alw26I	GTCTC	1 cut(s)	253
AlwI	GGATC	1 cut(s)	19
AoxI	GGCC	1 cut(s)	153
BanII	GRGCYC	2 cut(s)	116, 264
Bbv12I	GWGCWC	1 cut(s)	116
BccI	CCATC	1 cut(s)	46
BciT130I	CCWGG	1 cut(s)	201
BclI	TGATCA	1 cut(s)	253
BcoDI	GTCTC	1 cut(s)	253
Bme1390I	CCNGG	1 cut(s)	201
BmiI	GGNNCC	1 cut(s)	261
BmrFI	CCNGG	1 cut(s)	201
BoxI	GACNNNNGTC	1 cut(s)	201
Bsa29I	ATCGAT	1 cut(s)	23
BsaBI	GATNNNNATC	2 cut(s)	19, 29
BsaJI	CCNNGG	1 cut(s)	199
Bse8I	GATNNNNATC	2 cut(s)	19, 29
BseBI	CCWGG	1 cut(s)	201
BseCI	ATCGAT	1 cut(s)	23
BseDI	CCNNGG	1 cut(s)	199
BseJI	GATNNNNATC	2 cut(s)	19, 29
BseYI	CCCAGC	1 cut(s)	211
BshFI	GGCC	1 cut(s)	155
BshVI	ATCGAT	1 cut(s)	23
BsiHKAI	GWGCWC	1 cut(s)	116
BsmAI	GTCTC	1 cut(s)	253
BsnI	GGCC	1 cut(s)	155
Bsp1286I	GDGCHC	2 cut(s)	116, 264
Bsp143I	GATC	3 cut(s)	24, 138, 253
BspANI	GGCC	1 cut(s)	155
BspDI	ATCGAT	1 cut(s)	23
BspLI	GGNNCC	1 cut(s)	261
BspPI	GGATC	1 cut(s)	19
BssECI	CCNNGG	1 cut(s)	199
BssMI	GATC	3 cut(s)	24, 138, 253
Bst2UI	CCWGG	1 cut(s)	201
Bst4CI	ACNGT	2 cut(s)	76, 148
Bst6I	CTCTTC	2 cut(s)	173, 184
BstKTI	GATC	3 cut(s)	27, 141, 256
BstMAI	GTCTC	1 cut(s)	253
BstMBI	GATC	3 cut(s)	24, 138, 253
BstNI	CCWGG	1 cut(s)	201
BstPAI	GACNNNNGTC	1 cut(s)	201
BstSCI	CCNGG	1 cut(s)	199
Bsu15I	ATCGAT	1 cut(s)	23
BsuRI	GGCC	1 cut(s)	155
BsuTUI	ATCGAT	1 cut(s)	23
BtgZI	GCGATG	1 cut(s)	19
BtsIMutI	CAGTG	1 cut(s)	144
ClaI	ATCGAT	1 cut(s)	23
CviJI	RGCY	4 cut(s)	114, 155, 215, 262
CviKI_1	RGCY	4 cut(s)	114, 155, 215, 262
DpnI	GATC	3 cut(s)	26, 140, 255
DpnII	GATC	3 cut(s)	24, 138, 253
Eam1104I	CTCTTC	2 cut(s)	173, 184
EarI	CTCTTC	2 cut(s)	173, 184
Ecl136II	GAGCTC	1 cut(s)	114
Eco24I	GRGCYC	2 cut(s)	116, 264
Eco53kI	GAGCTC	1 cut(s)	114
EcoICRI	GAGCTC	1 cut(s)	114
EcoRII	CCWGG	1 cut(s)	199
EcoT38I	GRGCYC	2 cut(s)	116, 264
FaiI	YATR	2 cut(s)	220, 222
FbaI	TGATCA	1 cut(s)	253
FriOI	GRGCYC	2 cut(s)	116, 264
GsaI	CCCAGC	1 cut(s)	215
HaeIII	GGCC	1 cut(s)	155
HinfI	GANTC	2 cut(s)	15, 246
Hpy188I	TCNGA	3 cut(s)	129, 138, 253
Hpy188III	TCNNGA	1 cut(s)	257
Hpy99I	CGWCG	1 cut(s)	95
HpyCH4III	ACNGT	2 cut(s)	76, 148
HpyCH4IV	ACGT	1 cut(s)	132
HpyCH4V	TGCA	1 cut(s)	109
HpySE526I	ACGT	1 cut(s)	132
Ksp22I	TGATCA	1 cut(s)	253
Kzo9I	GATC	3 cut(s)	24, 138, 253
LmnI	GCTCC	1 cut(s)	259
LpnPI	CCDG	7 cut(s)	23, 105, 186, 213, 225, 240, 242
MaeII	ACGT	1 cut(s)	132
MaeIII	GTNAC	2 cut(s)	65, 203
MalI	GATC	3 cut(s)	26, 140, 255
MboI	GATC	3 cut(s)	24, 138, 253
MboII	GAAGA	4 cut(s)	133, 160, 171, 248
MhlI	GDGCHC	2 cut(s)	116, 264
MlyI	GAGTC	1 cut(s)	255
MnlI	CCTC	2 cut(s)	166, 176
MslI	CAYNNNNRTG	1 cut(s)	38
MspR9I	CCNGG	1 cut(s)	201
MvaI	CCWGG	1 cut(s)	201
NdeII	GATC	3 cut(s)	24, 138, 253
NlaIV	GGNNCC	1 cut(s)	261
NmuCI	GTSAC	1 cut(s)	203
PfeI	GAWTC	1 cut(s)	15
PleI	GAGTC	1 cut(s)	254
PpsI	GAGTC	1 cut(s)	254
PshAI	GACNNNNGTC	1 cut(s)	201
Psp124BI	GAGCTC	1 cut(s)	116
Psp1406I	AACGTT	1 cut(s)	132
Psp6I	CCWGG	1 cut(s)	199
PspFI	CCCAGC	1 cut(s)	211
PspGI	CCWGG	1 cut(s)	199
PspN4I	GGNNCC	1 cut(s)	261
RseI	CAYNNNNRTG	1 cut(s)	38
SacI	GAGCTC	1 cut(s)	116
Sau3AI	GATC	3 cut(s)	24, 138, 253
SchI	GAGTC	1 cut(s)	255
ScrFI	CCNGG	1 cut(s)	201
SduI	GDGCHC	2 cut(s)	116, 264
SetI	ASST	4 cut(s)	116, 135, 205, 217
SmiMI	CAYNNNNRTG	1 cut(s)	38
SstI	GAGCTC	1 cut(s)	116
StyD4I	CCNGG	1 cut(s)	199
TaaI	ACNGT	2 cut(s)	76, 148
TaiI	ACGT	1 cut(s)	135
TaqI	TCGA	3 cut(s)	23, 90, 195
TfiI	GAWTC	1 cut(s)	15
TscAI	CASTG	1 cut(s)	151
TseFI	GTSAC	1 cut(s)	203
Tsp45I	GTSAC	1 cut(s)	203
TspDTI	ATGAA	4 cut(s)	17, 49, 76, 207
TspRI	CASTG	1 cut(s)	151

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.