Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0000014.1

Orthogroup ID

OG0008271

Physical Location & Seq

Genomic Coordinates Reverse (-)

77866 .. 83939

Gene Structure 6074 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0000014.1_g000014.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 1320 bp

atgggtgttctagcttttgcagctttggttttcttggccatggctggccagtcaagtgccaattggtgtgtgtgcaagagtgggagtgatgcagtattgcagaagacattggactatgcctgtggagctggggctgactgtaaccccatacatccaaatggggcttgctacaaccctaacactgttaaagctcactgcgactatgctgtcaacagctatttccagaagaagggccaagctcaaggcacctgtgactttgccggcaccgcaacccctgttacatccgatcccagcgttactggttgtgttttcccatctagcgccagttcttccggcagtacgactccaagtaccggcacaaccaccccaagtaccggcaccaccaccccaaccaccggcaccaccaccccaaccaccggcacaacacccacaagtaccaacacaacaccaacaaccaccggaacaaccacaggaacaaccactgggacaaccaccggtgccactccatacactgcaactcccggagtatttggagtagggccatctggagctggcatcacggatgacagtgctgggattagactcattgacactactagggaagcggtggctaatcctgcagggattgaggcggctgtggtgaatctgattggggatggcgaagcggtccatgatcctttcttttatctctgtggacgtctgctatcttcgaagcgcgtgggtggcggtttgacggggcttcgtattgctatgcgtaatgaacgagtcctaaccctacttggaaaggatttggggcagtttgtatggttttatcaagcggcaatggtgaggaaggatcagattcagaggattcgggtgatccatgatgtacaacttcaaatatgggctcagcgcatgtacaacttttcgccggtggtggcagtggctctagagttcaggtacgaaaagtgccatggcatctgcaagaggtgcgggttcttcgcatctgtggcggcggcggcggggccagagatgctccttatagggctggcgaagctgggcttgatgtcaaagatggctgaagatatggtggtggtggatggaccagcgccggatgttgcagcaagtgttgctgtgaatgctccagaaaaacctgcggggaaccctaatttagaattagggttgaccgcaggttttactgggctgcacagaattgggccaggtgacatctctaatgtgggtgtgggctctgctggatcttcttctaggcttagggctaaaagaggcccaatggtggattttggtgttaagaagaagatctttgttaacgttagagattga

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0001871 GO:0001872 GO:0003674 GO:0003824 GO:0004553 GO:0005488 GO:0005575 GO:0005618 GO:0005623 GO:0005886 GO:0005911 GO:0006950 GO:0008150 GO:0009266 GO:0009408 GO:0009505 GO:0009506 GO:0009628 GO:0009987 GO:0016020 GO:0016043 GO:0016787 GO:0016798 GO:0030054 GO:0030246 GO:0030247 GO:0030312 GO:0031224 GO:0031225 GO:0031226 GO:0033036 GO:0033037 GO:0042545 GO:0044425 GO:0044459 GO:0044464 GO:0045229 GO:0046658 GO:0050896 GO:0051179 GO:0051641 GO:0052386 GO:0052543 GO:0052545 GO:0055044 GO:0070727 GO:0071554 GO:0071555 GO:0071840 GO:0071944

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

Protein Analysis

439

Amino Acids

45.27

Weight (kDa)

8.55

Isoelectric Point (pI)

25.04

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0008271)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT1G18650 AT1G18650 AT5G08000 AT5G08000 AT5G61130
fragaria_vesca	FvH4_5g13960
malus_domestica	MD06G1202000.v1.1 MD14G1210900.v1.1 MD14G1211200.v1.1
prunus_persica	Prupe.5G203900_v2.0.a1 Prupe.5G203900_v2.0.a1
pyrus_communis	pycom14g17430 pycom14g17450
rosa_chinensis	RchiOBHm_Chr7g0182991
rosa_laevigata	RLG00000005092
rosa_multiflora	Rmu_sc0000014.1_g000014
rosa_roxburghii	Rroxscaffold_3G00270910
rosa_rugosa	Rorug06G0451500
rosa_samantha	Rh7AG054800 Rh7BG054300 Rh7CG055800 Rh7DG054200
rosa_wichuraiana	Rw7G004470

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AasI	GACNNNNNNGTC	1 cut(s)	206
AatII	GACGTC	1 cut(s)	700
Acc36I	ACCTGC	2 cut(s)	1141, 1160
AccB1I	GGYRCC	5 cut(s)	245, 263, 377, 398, 497
AccII	CGCG	1 cut(s)	717
AclI	AACGTT	1 cut(s)	1308
AclWI	GGATC	5 cut(s)	281, 668, 843, 853, 1243
AcoI	YGGCCR	2 cut(s)	36, 46
AcuI	CTGAAG	1 cut(s)	1080
AcyI	GRCGYC	1 cut(s)	697
AfaI	GTAC	7 cut(s)	340, 352, 373, 436, 870, 899, 941
AfiI	CCNNNNNNNGG	6 cut(s)	229, 353, 374, 395, 416, 1273
AgeI	ACCGGT	1 cut(s)	494
AgsI	TTSAA	1 cut(s)	878
AjnI	CCWGG	1 cut(s)	1198
AluBI	AGCT	8 cut(s)	14, 23, 128, 191, 216, 239, 551, 1036
AluI	AGCT	8 cut(s)	14, 23, 128, 191, 216, 239, 551, 1036
AlwI	GGATC	5 cut(s)	281, 668, 843, 853, 1243
AoxI	GGCC	7 cut(s)	36, 46, 232, 539, 1004, 1196, 1264
ApeKI	GCWGC	3 cut(s)	20, 1100, 1183
AsiGI	ACCGGT	1 cut(s)	494
AspLEI	GCGC	4 cut(s)	323, 717, 894, 1090
AspS9I	GGNCC	7 cut(s)	232, 539, 667, 1004, 1082, 1196, 1265
AsuC2I	CCSGG	1 cut(s)	522
AsuHPI	GGTGA	4 cut(s)	652, 838, 868, 1214
AsuII	TTCGAA	1 cut(s)	710
AvaII	GGWCC	2 cut(s)	667, 1082
BalI	TGGCCA	2 cut(s)	38, 48
BanI	GGYRCC	5 cut(s)	245, 263, 377, 398, 497
BanII	GRGCYC	2 cut(s)	889, 1229
BbsI	GAAGAC	1 cut(s)	110
BbvI	GCAGC	3 cut(s)	32, 1112, 1170
BccI	CCATC	5 cut(s)	322, 550, 650, 1048, 1073
BciT130I	CCWGG	1 cut(s)	1200
BcnI	CCSGG	1 cut(s)	522
BfaI	CTAG	5 cut(s)	11, 318, 597, 929, 1245
BfmI	CTRYAG	1 cut(s)	618
BfoI	RGCGCY	2 cut(s)	324, 1091
BfuAI	ACCTGC	2 cut(s)	1141, 1160
BglII	AGATCT	1 cut(s)	1296
BisI	GCNGC	8 cut(s)	21, 633, 819, 993, 996, 999, 1101, 1184
BlpI	GCTNAGC	1 cut(s)	888
BlsI	GCNGC	8 cut(s)	22, 634, 820, 994, 997, 1000, 1102, 1185
Bme1390I	CCNGG	2 cut(s)	522, 1200
Bme18I	GGWCC	2 cut(s)	667, 1082
BmgT120I	GGNCC	7 cut(s)	232, 539, 667, 1004, 1082, 1196, 1265
BmiI	GGNNCC	7 cut(s)	247, 265, 379, 400, 499, 1005, 1142
BmrFI	CCNGG	2 cut(s)	522, 1200
BmrI	ACTGGG	2 cut(s)	492, 1188
BmsI	GCATC	5 cut(s)	79, 564, 966, 992, 1002
BmuI	ACTGGG	2 cut(s)	492, 1188
BpiI	GAAGAC	1 cut(s)	110
BpmI	CTGGAG	2 cut(s)	567, 1107
Bpu10I	CCTNAGC	1 cut(s)	1250
Bpu1102I	GCTNAGC	1 cut(s)	888
Bpu14I	TTCGAA	1 cut(s)	710
BpuEI	CTTGAG	1 cut(s)	225
BpuMI	CCSGG	1 cut(s)	522
BsaHI	GRCGYC	1 cut(s)	697
BsaJI	CCNNGG	2 cut(s)	39, 952
BsaWI	WCCGGW	2 cut(s)	458, 494
BsaXI	ACNNNNNCTCC	2 cut(s)	502, 532
Bsc4I	CCNNNNNNNGG	6 cut(s)	229, 353, 374, 395, 416, 1273
Bse118I	RCCGGY	7 cut(s)	260, 353, 374, 395, 416, 494, 910
Bse1I	ACTGG	5 cut(s)	49, 304, 324, 487, 1183
Bse3DI	GCAATG	1 cut(s)	828
BseBI	CCWGG	1 cut(s)	1200
BseDI	CCNNGG	2 cut(s)	39, 952
BseGI	GGATG	6 cut(s)	151, 281, 568, 661, 1084, 1099
BseLI	CCNNNNNNNGG	6 cut(s)	229, 353, 374, 395, 416, 1273
BseMI	GCAATG	1 cut(s)	828
BseMII	CTCAG	1 cut(s)	902
BseNI	ACTGG	5 cut(s)	49, 304, 324, 487, 1183
BseXI	GCAGC	3 cut(s)	32, 1112, 1170
BseYI	CCCAGC	4 cut(s)	128, 290, 572, 1036
BsgI	GTGCAG	1 cut(s)	1169
Bsh1236I	CGCG	1 cut(s)	717
BshFI	GGCC	7 cut(s)	38, 48, 234, 541, 1006, 1198, 1266
BshNI	GGYRCC	5 cut(s)	245, 263, 377, 398, 497
BshTI	ACCGGT	1 cut(s)	494
BslFI	GGGAC	1 cut(s)	499
BslI	CCNNNNNNNGG	6 cut(s)	229, 353, 374, 395, 416, 1273
BsmFI	GGGAC	1 cut(s)	499
BsmI	GAATGC	1 cut(s)	1123
BsnI	GGCC	7 cut(s)	38, 48, 234, 541, 1006, 1198, 1266
Bsp119I	TTCGAA	1 cut(s)	710
Bsp1286I	GDGCHC	2 cut(s)	889, 1229
Bsp1407I	TGTACA	2 cut(s)	868, 897
Bsp143I	GATC	6 cut(s)	286, 673, 835, 858, 1235, 1296
Bsp1720I	GCTNAGC	1 cut(s)	888
Bsp19I	CCATGG	2 cut(s)	39, 952
BspANI	GGCC	7 cut(s)	38, 48, 234, 541, 1006, 1198, 1266
BspCNI	CTCAG	1 cut(s)	901
BspFNI	CGCG	1 cut(s)	717
BspLI	GGNNCC	7 cut(s)	247, 265, 379, 400, 499, 1005, 1142
BspMAI	CTGCAG	1 cut(s)	622
BspMI	ACCTGC	2 cut(s)	1141, 1160
BspPI	GGATC	5 cut(s)	281, 668, 843, 853, 1243
BspT104I	TTCGAA	1 cut(s)	710
BspT107I	GGYRCC	5 cut(s)	245, 263, 377, 398, 497
BsrDI	GCAATG	1 cut(s)	828
BsrFI	RCCGGY	7 cut(s)	260, 353, 374, 395, 416, 494, 910
BsrGI	TGTACA	2 cut(s)	868, 897
BsrI	ACTGG	5 cut(s)	49, 304, 324, 487, 1183
BssAI	RCCGGY	7 cut(s)	260, 353, 374, 395, 416, 494, 910
BssECI	CCNNGG	2 cut(s)	39, 952
BssMI	GATC	6 cut(s)	286, 673, 835, 858, 1235, 1296
BssNI	GRCGYC	1 cut(s)	697
BssT1I	CCWWGG	2 cut(s)	39, 952
Bst2UI	CCWGG	1 cut(s)	1200
Bst4CI	ACNGT	3 cut(s)	140, 184, 569
BstACI	GRCGYC	1 cut(s)	697
BstAPI	GCANNNNNTGC	2 cut(s)	969, 1109
BstAUI	TGTACA	2 cut(s)	868, 897
BstBI	TTCGAA	1 cut(s)	710
BstC8I	GCNNGC	5 cut(s)	46, 166, 262, 553, 1029
BstDEI	CTNAG	2 cut(s)	888, 1250
BstDSI	CCRYGG	2 cut(s)	39, 952
BstF5I	GGATG	6 cut(s)	151, 281, 568, 661, 1084, 1099
BstFNI	CGCG	1 cut(s)	717
BstH2I	RGCGCY	2 cut(s)	324, 1091
BstHHI	GCGC	4 cut(s)	323, 717, 894, 1090
BstKTI	GATC	6 cut(s)	289, 676, 838, 861, 1238, 1299
BstMBI	GATC	6 cut(s)	286, 673, 835, 858, 1235, 1296
BstNI	CCWGG	1 cut(s)	1200
BstNSI	RCATGY	1 cut(s)	898
BstSCI	CCNGG	2 cut(s)	520, 1198
BstSFI	CTRYAG	1 cut(s)	618
BstUI	CGCG	1 cut(s)	717
BstV1I	GCAGC	3 cut(s)	32, 1112, 1170
BstV2I	GAAGAC	1 cut(s)	110
BstX2I	RGATCY	2 cut(s)	1235, 1296
BstYI	RGATCY	2 cut(s)	1235, 1296
BsuRI	GGCC	7 cut(s)	38, 48, 234, 541, 1006, 1198, 1266
BtgI	CCRYGG	2 cut(s)	39, 952
BtsCI	GGATG	6 cut(s)	151, 281, 568, 661, 1084, 1099
BtsI	GCAGTG	3 cut(s)	193, 510, 927
BtsIMutI	CAGTG	6 cut(s)	180, 193, 480, 510, 574, 927
BveI	ACCTGC	2 cut(s)	1141, 1160
Cac8I	GCNNGC	5 cut(s)	46, 166, 262, 553, 1029
CfoI	GCGC	4 cut(s)	323, 717, 894, 1090
Cfr10I	RCCGGY	7 cut(s)	260, 353, 374, 395, 416, 494, 910
Cfr13I	GGNCC	7 cut(s)	232, 539, 667, 1004, 1082, 1196, 1265
Csp6I	GTAC	7 cut(s)	339, 351, 372, 435, 869, 898, 940
CspAI	ACCGGT	1 cut(s)	494
CviAII	CATG	5 cut(s)	40, 671, 863, 895, 953
CviQI	GTAC	7 cut(s)	339, 351, 372, 435, 869, 898, 940
DdeI	CTNAG	2 cut(s)	888, 1250
DpnI	GATC	6 cut(s)	288, 675, 837, 860, 1237, 1298
DpnII	GATC	6 cut(s)	286, 673, 835, 858, 1235, 1296
DrdI	GACNNNNNNGTC	1 cut(s)	206
DseDI	GACNNNNNNGTC	1 cut(s)	206
EaeI	YGGCCR	2 cut(s)	36, 46
Eco130I	CCWWGG	2 cut(s)	39, 952
Eco24I	GRGCYC	2 cut(s)	889, 1229
Eco47I	GGWCC	2 cut(s)	667, 1082
Eco57I	CTGAAG	1 cut(s)	1080
EcoRII	CCWGG	1 cut(s)	1198
EcoT14I	CCWWGG	2 cut(s)	39, 952
EcoT38I	GRGCYC	2 cut(s)	889, 1229
ErhI	CCWWGG	2 cut(s)	39, 952
FaeI	CATG	5 cut(s)	43, 674, 866, 898, 956
FalI	AAGNNNNNCTT	4 cut(s)	1025, 1057, 1283, 1315
FaqI	GGGAC	1 cut(s)	499
FatI	CATG	5 cut(s)	39, 670, 862, 894, 952
FauI	CCCGC	3 cut(s)	965, 994, 1129
Fnu4HI	GCNGC	8 cut(s)	21, 633, 819, 993, 996, 999, 1101, 1184
FokI	GGATG	6 cut(s)	138, 268, 575, 668, 1091, 1106
FriOI	GRGCYC	2 cut(s)	889, 1229
Fsp4HI	GCNGC	8 cut(s)	21, 633, 819, 993, 996, 999, 1101, 1184
FspBI	CTAG	5 cut(s)	11, 318, 597, 929, 1245
GlaI	GCGC	4 cut(s)	322, 716, 893, 1089
GluI	GCNGC	8 cut(s)	21, 633, 819, 993, 996, 999, 1101, 1184
GsaI	CCCAGC	4 cut(s)	132, 294, 576, 1040
GsuI	CTGGAG	2 cut(s)	567, 1107
HaeII	RGCGCY	2 cut(s)	324, 1091
HaeIII	GGCC	7 cut(s)	38, 48, 234, 541, 1006, 1198, 1266
HhaI	GCGC	4 cut(s)	323, 717, 894, 1090
Hin1I	GRCGYC	1 cut(s)	697
Hin1II	CATG	5 cut(s)	43, 674, 866, 898, 956
Hin6I	GCGC	4 cut(s)	321, 715, 892, 1088
HinP1I	GCGC	4 cut(s)	321, 715, 892, 1088
HincII	GTYRAC	3 cut(s)	211, 1164, 1306
HindII	GTYRAC	3 cut(s)	211, 1164, 1306
HinfI	GANTC	6 cut(s)	343, 582, 643, 765, 841, 850
HpaI	GTTAAC	1 cut(s)	1306
HphI	GGTGA	4 cut(s)	652, 838, 868, 1214
Hpy166II	GTNNAC	4 cut(s)	211, 695, 1164, 1306
Hpy188I	TCNGA	4 cut(s)	286, 648, 840, 846
Hpy188III	TCNNGA	4 cut(s)	223, 546, 929, 1124
Hpy8I	GTNNAC	4 cut(s)	211, 695, 1164, 1306
HpyAV	CCTTC	2 cut(s)	223, 826
HpyCH4III	ACNGT	3 cut(s)	140, 184, 569
HpyCH4IV	ACGT	2 cut(s)	697, 1308
HpyCH4V	TGCA	9 cut(s)	20, 75, 92, 100, 515, 620, 963, 1100, 1186
HpyF3I	CTNAG	2 cut(s)	888, 1250
HpySE526I	ACGT	2 cut(s)	697, 1308
Hsp92I	GRCGYC	1 cut(s)	697
Hsp92II	CATG	5 cut(s)	43, 674, 866, 898, 956
HspAI	GCGC	4 cut(s)	321, 715, 892, 1088
KroI	GCCGGC	1 cut(s)	260
KroNI	GCCGGC	1 cut(s)	262
KspAI	GTTAAC	1 cut(s)	1306
Kzo9I	GATC	6 cut(s)	286, 673, 835, 858, 1235, 1296
LmnI	GCTCC	4 cut(s)	125, 548, 1020, 1126
Lsp1109I	GCAGC	3 cut(s)	32, 1112, 1170
LweI	GCATC	5 cut(s)	79, 564, 966, 992, 1002
MaeI	CTAG	5 cut(s)	11, 318, 597, 929, 1245
MaeII	ACGT	2 cut(s)	697, 1308
MaeIII	GTNAC	5 cut(s)	140, 251, 277, 295, 1202
MalI	GATC	6 cut(s)	288, 675, 837, 860, 1237, 1298
MboI	GATC	6 cut(s)	286, 673, 835, 858, 1235, 1296
MfeI	CAATTG	1 cut(s)	61
MflI	RGATCY	2 cut(s)	1235, 1296
MhlI	GDGCHC	2 cut(s)	889, 1229
MlsI	TGGCCA	2 cut(s)	38, 48
MluCI	AATT	4 cut(s)	61, 1147, 1154, 1191
MluNI	TGGCCA	2 cut(s)	38, 48
MlyI	GAGTC	3 cut(s)	337, 576, 774
MnlI	CCTC	5 cut(s)	622, 822, 840, 960, 1256
Mox20I	TGGCCA	2 cut(s)	38, 48
MroNI	GCCGGC	1 cut(s)	260
MscI	TGGCCA	2 cut(s)	38, 48
MseI	TTAA	3 cut(s)	186, 1287, 1305
MslI	CAYNNNNRTG	1 cut(s)	156
Msp20I	TGGCCA	2 cut(s)	38, 48
MspR9I	CCNGG	2 cut(s)	522, 1200
MunI	CAATTG	1 cut(s)	61
Mva1269I	GAATGC	1 cut(s)	1123
MvaI	CCWGG	1 cut(s)	1200
MvnI	CGCG	1 cut(s)	717
NaeI	GCCGGC	1 cut(s)	262
NciI	CCSGG	1 cut(s)	522
NcoI	CCATGG	2 cut(s)	39, 952
NdeII	GATC	6 cut(s)	286, 673, 835, 858, 1235, 1296
NgoMIV	GCCGGC	1 cut(s)	260
NlaIII	CATG	5 cut(s)	43, 674, 866, 898, 956
NlaIV	GGNNCC	7 cut(s)	247, 265, 379, 400, 499, 1005, 1142
NmuCI	GTSAC	2 cut(s)	251, 1202
NspI	RCATGY	1 cut(s)	898
NspV	TTCGAA	1 cut(s)	710
PctI	GAATGC	1 cut(s)	1123
PdiI	GCCGGC	1 cut(s)	262
PfeI	GAWTC	3 cut(s)	643, 841, 850
PfoI	TCCNGGA	1 cut(s)	520
PinAI	ACCGGT	1 cut(s)	494
PkrI	GCNGC	8 cut(s)	22, 634, 820, 994, 997, 1000, 1102, 1185
PleI	GAGTC	3 cut(s)	337, 576, 773
PpsI	GAGTC	3 cut(s)	337, 576, 773
Psp1406I	AACGTT	1 cut(s)	1308
Psp6I	CCWGG	1 cut(s)	1198
PspFI	CCCAGC	4 cut(s)	128, 290, 572, 1036
PspGI	CCWGG	1 cut(s)	1198
PspN4I	GGNNCC	7 cut(s)	247, 265, 379, 400, 499, 1005, 1142
PspPI	GGNCC	7 cut(s)	232, 539, 667, 1004, 1082, 1196, 1265
PstI	CTGCAG	1 cut(s)	622
PsuI	RGATCY	2 cut(s)	1235, 1296
RsaI	GTAC	7 cut(s)	340, 352, 373, 436, 870, 899, 941
RsaNI	GTAC	7 cut(s)	339, 351, 372, 435, 869, 898, 940
RseI	CAYNNNNRTG	1 cut(s)	156
SaqAI	TTAA	3 cut(s)	186, 1287, 1305
SatI	GCNGC	8 cut(s)	21, 633, 819, 993, 996, 999, 1101, 1184
Sau3AI	GATC	6 cut(s)	286, 673, 835, 858, 1235, 1296
Sau96I	GGNCC	7 cut(s)	232, 539, 667, 1004, 1082, 1196, 1265
SbfI	CCTGCAGG	1 cut(s)	622
SchI	GAGTC	3 cut(s)	337, 576, 774
ScrFI	CCNGG	2 cut(s)	522, 1200
SdaI	CCTGCAGG	1 cut(s)	622
SduI	GDGCHC	2 cut(s)	889, 1229
SfaNI	GCATC	5 cut(s)	79, 564, 966, 992, 1002
SfcI	CTRYAG	1 cut(s)	618
SfuI	TTCGAA	1 cut(s)	710
SgrAI	CRCCGGYG	2 cut(s)	494, 910
SinI	GGWCC	2 cut(s)	667, 1082
SmiMI	CAYNNNNRTG	1 cut(s)	156
SmlI	CTYRAG	1 cut(s)	240
SmoI	CTYRAG	1 cut(s)	240
Sse8387I	CCTGCAGG	1 cut(s)	622
Sse9I	AATT	4 cut(s)	61, 1147, 1154, 1191
SspMI	CTAG	5 cut(s)	11, 318, 597, 929, 1245
StyD4I	CCNGG	2 cut(s)	520, 1198
StyI	CCWWGG	2 cut(s)	39, 952
TaaI	ACNGT	3 cut(s)	140, 184, 569
TaiI	ACGT	2 cut(s)	700, 1311
TaqI	TCGA	1 cut(s)	710
TasI	AATT	4 cut(s)	61, 1147, 1154, 1191
TatI	WGTACW	2 cut(s)	868, 897
TauI	GCSGC	5 cut(s)	635, 821, 995, 998, 1001
TfiI	GAWTC	3 cut(s)	643, 841, 850
Tru1I	TTAA	3 cut(s)	186, 1287, 1305
Tru9I	TTAA	3 cut(s)	186, 1287, 1305
TscAI	CASTG	6 cut(s)	187, 200, 487, 517, 574, 927
TseFI	GTSAC	2 cut(s)	251, 1202
TseI	GCWGC	3 cut(s)	20, 1100, 1183
Tsp45I	GTSAC	2 cut(s)	251, 1202
TspDTI	ATGAA	1 cut(s)	774
TspGWI	ACGGA	1 cut(s)	575
TspRI	CASTG	6 cut(s)	187, 200, 487, 517, 574, 927
VpaK11BI	GGWCC	2 cut(s)	667, 1082
XbaI	TCTAGA	1 cut(s)	928
XceI	RCATGY	1 cut(s)	898
XspI	CTAG	5 cut(s)	11, 318, 597, 929, 1245
ZraI	GACGTC	1 cut(s)	698

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.